Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.48
Orientation:
(+)
Number of Exons:
6
Description :
Protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
108-127
1-87
151-155
88-107
128-150
NN-scoreoddsWeighted Score
0.9486.8210.014
*** None ***
TypeScore
endoplasmic reticulum348
GO
*** None ***
*** None ***
*** None ***
Sequence
        1659 bases(100 bases per row)
ATGGAGTCGCCTCCGCGGTTGGGTCTGCCGGACGACGCCTCGAACTCGCCGACGCCGAACACGAGCTTCTGTCTGCTGGAAGCGCGCGACTCGCACAACG
ACATCGTCGTGCCCGTGGCGAACGACGACGGCGCTCCAGCAGCGCGCATGAATGCCCGACAACGACAGCAGCCGCAGTACCCGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGACCTCTTCCCGATGATCAACGCGAATGTGTTCACCAACCCGGAGAACATCATGCCGTCACACCAG
GACGCGATCATGATCGACGATATCCACGACCACTTGTCCAGTTTCCACAGCACGAACAACAACACTCTCAACAACAACGGCACGCTGATGGCGCAGAACA
GACTCAGCGCCAACCAATTATCCATCGGCACGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACGATGCGCGGCTGAGCAGCAGCTCGCACGACTCGCTCAGCGACACGCTGCGCACGAACGCGTCGTTC
ACGTTCCGCAGGACGCCCAAGCAGTNNNNNNNNNNTACTCTCGCTCTGGAAGCGATTCAACATCAACTGGGACTCGTACTTTTTGCTGTTCACGCTGGGG
ATCTCCATCGCTGCGATCCCCGTCGGCGNNNNNNNNNNTCACGCGCGCCCACACAAGAACTACAAGCTGCGCTGCAAACGGGCGACGCCCGTCCGCGAAG
ACACGATTGCATCCACGGCCGCCGTCACGATCCCGACGCTCAACTTGCTCGTGCTGCTAGTCATCTCGCTCTGGGTCGCGGTTCGATGCAGTCAAAGCCG
CAAGCGCGTGCTGCGAAGCACGGCTGCCACCAGCGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGTACGTACAC
GCTGCTGCTTCACATATTGCAGTGTATTTGGAAAATGCCGATAGGCTAACATGTGTTTTCTGTTTGTATCGTGAAAACTGTAGCGTCGGCGTTCATGCTG
CCATGCTACGAAGCCATTTGGTACATGATTGCGTTCCTCTCGTGCTGCGGCATTGCACTGTACGGCGTGAGCTATTCGCCCATGGCGCTGAGTTATTCCG
ACGAAGCTGTCGCAGAAGTGTCCGACTCGGTCCCAGAGAACGACGACGCGCTGTACCCGTGCACCATTGCCACACTGCCGTCCGTGTGGATCCTGCAGCT
CTTGCCGATGCTCATGNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCGCAGCGTGTCCCAAGAAGCCGTCGTGCGCTCGATTGTGTACTCTGGCGCCGTGT
GTATCGTGATGCTGGTGCTGTACATGAGTTTGTTCACGCAGAATGGCGGCGTTGCGATGAACGCGATCTCTGTCGCTGTACATTTCGTGCTGCTGTGCTT
TTACTTTTGGGCGAAGTTCGTGTTCCACGCGCGGTCATCGTTTGATTTCTTTTTCGTAG