Transcript Name :
Pytul_var.sporangiiferumfgenesh-pug3_contig_1-abinit-gene-1.39
Orientation:
(+)
Number of Exons:
2
Description :
Microtubule-associated protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain9.241PS50222
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        1144 bases(100 bases per row)
ATGGGGAACACACTGCAGGCCGCGCTGAAGGACCACGATGCCTTCGCGCTCGTCGACGTGATCCTGCCGTACGACAACCTGCATATCAATGCGATTGAAG
CGTACTGGCGCAGCTTCTACGACGTCGCGACGTCGTTTGCGCTCACGAAAGTGCAGCTCCGCCAGATTTGCTGTCGCACTGCATGCTTCTTGGACCCCCA
TGCGTCGACACAGCGCGCAATGAACCATGCCGATCACGCGTTTGAGCTCTTCCTAGACCCGCAATGGCGGCAATCTCACCACCACCAGCAGCAGCAATCC
CAACGATATCAGCAGCAACAGCAACTACAGCCACAGCAGCACCCGTTTGTCATCGACGCACTCGAGTTCTTCTCAGCGATCGCGTTCGTGAGTGCGAGCT
CCATGGACGAGAAGATCGATCTGATCTTTGACTCGTGGGATATGTCGGAAGACGGCGCGCTCGACCTCGACGAGTTCACGATCTCGCTCAAATCGACGCT
CGCTGGTCTCGGGAAGATCCTCAAGCCGACTTCTCAATCCGCTGCGACAAAGCATCACTTTGACGCAGTCTCCGGTATTATTGACGAACAGGAAGTCGAT
CTGCTGGCTGACCGGATTTTCCGTGAAATCGCAAACGCCCCGCCGTCCTCGAGCGGTGTGAACCAGATCTCCATCACGTGTGAGCAATTCCGAGAGTACT
GCACGCGAAACAAAACAGCGAAGAACCTGTTTGAGTTTTTCGACCTTGCCGATGCGAGTTTGCTGGAAGAAGACGGCGAAGAAGGCGATAATTCACTGTT
TCTAGAAATGAACGAAGAAGCGAGATTAGTCCACAACGCACTCGCAAAAGCTCGCGTGTCAGATGAGAGTTCGCCATCAACTGTTGACATTAGCGCAGAA
GACCATGGTGATGAATTTTTGGCAGTCAAGCCGTGGAAAGGTGCAATTGTACCGCCCAGTAAGATTCCACCAACTTTGTCAAAAGCTGTACCACTTGTGT
CGATCAAATTGGATTGGATCTTTGGCTACAGCGCCCAGGAGGGGAAAAACAACGTGCGTTACATACTCACCCACGGCGTCAACAACATGAACAATCAGCC
AGAAGAAATTGTGTATCCCGCAGCTGCGGCCTGCGTCGTGCTGA