Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-1.10
Orientation:
(+)
Number of Exons:
3
Description :
Microtubule-associated protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-498
NN-scoreoddsWeighted Score
0.5921.4520.003
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        2718 bases(100 bases per row)
ATGACATCAACGCTGGGGTGGTCTGTTCAAGGTATATGGGAAGAAGAAAGTGACGGCACAGACGTGAACGCGGTTGATCGATCAAAGGACGGGACTCTGC
TAGCGACAGGAGACGATTTCGGCAAGGTCAAAGTGTTCCGATATCCTTGTGCCCTTGAAAAGGCGTCGTCGGTCGAGCTTCGTGGCCACGCCTCCCACGT
GACTAATGTGAGGTGGTCACCACATGACCACTTCATCGTTTCAGTCGGAGGTAATGACCGTTGCGTGTTTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCATGCTGTTGGGGGCAACCAAGACGCTCAGACAAATCGCGATAGCGATC
CTCTTGAAATGGCGTCTGCGATTGATGATGTAGGTGATGAATTTATGGCTGTGAAGCCGTGGCTCGGCGCAGTCGTTGCTCCATCGAGTGCGAGTGAAAT
GAACTTGAAAAGCACATCCCCCGATGCATATCTGGAACTGGAACGAGTTCACGGGTATCAAGCTCAAAACGTGGCTAACAATGCTCGCTATGACAGTAAT
GGGAAAATCATCTACCATGGTGCAGCACTGGGAATCATATACGACAAGAGTAAACAACGCCAGTCGTTTTTCAAGAGCCACGATGACGATATCATTGGGT
TATGCGCACATCCAAATGGATCCATTTTCGCAACTGCCCAAATGGGCAAGAACCCAAAGATTTACACTTGGAACTCCAGCACTGGAGCAGCTTTGTCATG
CCTGGAGGGTTTTCACCAGCGGTTCGTGTCTGCTATTTGCTTCTCGAGCGATGGCAAGAAACTTGGGAGTGTCGGAGGCGACGATGACCATTCGGTTGCA
ATTTACTCTTGGGAGAATGGGATTCTGACGTCGAGCGCGAAAGGAGAACGCAACAATGTCCTCGGTATGTGTTTCCACAACACCACTGACGAATGGATCA
CGTGCGGAGCGAAGCATATCCGCTTCTGGCAAGAACAGGGAAAAAATCTCACGTCCAAGAAGGCGATCTTTGGCAAAGCGAAGCATAAGGATGGGAAAGC
ACCAACGGCATTTGAATGCGTTGTCTCATTTGGTAAACTGGTCGTGGTGGGTGCCTCGAACGGCGATCTCTACGTGTTCCAGTCGTCAAATGATTTATCG
AGGATTGTGACCGGCCATGCGTCCAATGCTTTCGCCCTTTACTCAAGTGGCAAAGATGGACACGAACTCGTTTCGGGTGGGAAAGACTCCAAGATCATGA
TCTGGGACTCGGACGTGAAGCCACTGGCCACTGTGGATCTGAAACAGCAAGCGGCCGCAGTGTGGCTCTATAATTCGTCCATTCGGTCAGTGTGTACGAG
CAATCGCTCTTCGAGAGTGTTCCTAGTCGGAACAGGCGGAAGCGACCTACTTGAAGTTGACGCAAGTAGATCTGATATCTCGTTCAATATCATTACTCAA
GGCCACTACAACATGGAAGTCTGGGGACTCGCTTGCCACCCAAAGAAACCAGAATACTGCACAGTTGGAGACGACCAAACGCTTCGAGTTTGGTGTTTGA
ACACAAAAGTACAGCTACGTACCAAGAAGCTGGACTGTATGGCTCGCGCATGTGCTATTGATGACCGTTTGGATGTGGTTGCAGTAGGCTACGGGGGGCG
AAATGCCCAGCAAGTGCCGTCAAAAGCTTCGCAAGCCAAGATAGGCAGCATTGTGCTTTTTCGCTACGGTGACCTGGCAAAACTGTTCGAAGACAAACCT
TCGAAGCAGCCGATCAGCGAGGTGAAATTCTCCCCGAATAGTTCTGTCCTAGCTGTTGGTTCCCACGATCACCACATCTACTTGTACAAAATCCACGACG
TCAGCTGCAAGAAGGTGACCAAGACTGCGACGTTTGCGAAACATCAGAGCTACATCACCCATATCGACTTTTCAAGCGACAGCAAAGTCCTTCAAAGCAA
CTGTGGTGCCTACGAGCTTCTCTTCAGTGATGCGACCAACGGTAGACACATCACGTCTGCCAGCAGCACGAAGGACACGCAATGGCAGACGTGGACATGC
GTACTTGGATGGCCAGTGCAGGGCATCTGGCCTCCTTGTTCTGATGGCACCGACGTGAATGCCGTCGATCGCAACTCGAAAGGCAACCTGATTGCGACGT
CGGATGACTTTGGACTCGTTAAGCTCTATCGCTACCCATGTGTCACCAAAAACGCGAGCTCCACAGAAAATCGTGGCCATTCGTCTCACGTCACGAATGT
CCGATGGAGTGCGAATGATACTCACGTGATAAGCGTCGGAGGAAACGATCGATGCATCATGGAGTGGAAAGTTATGAATGACGGTGAGGAGAAAGTCTCT
GGAAACCAACAGGAGGCACTTCATGAAAAGTTTAGTACTTTGAACAACCAAGACAAAAATGACGATGATGAGGGTGACGAAGACAATAACTTGATGGACG
ATCCCTCGGGCGATGAGTTTATGGCCGTCAAGCCGTGGGTCGGAGCCATCGTTGCACCAAGCAACGCACCGACACCAAACTCCCGCGAGCCTGATCTTCA
GCTCGAACTTGACTGGGTGTATGGGTATCAAACAGAGTTGTCGCACCAGAACCTCGTCTACAATGATCGCGATGAAATCGTGTATCACACGGCAGCCGTC
GGCATCATCTACGATCCG