Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.66
Orientation:
(-)
Number of Exons:
2
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2481 bases(100 bases per row)
ATGGCGCTAGTGGGCGGCGTCACAAGCGCAGATGTCAGTGTTCAAGACCTGCAGCCCGATATGAAGAACGATGACATACTGATGGCAAATTTTCAAGCTC
AGCGACAGTTACGTGGAGGAGTTGATATCGACGCACACTCAGATAATCCAATGCAGCGACAACTGGCAGGTGTTGAAGAGGCTACGAGTGTGTCGGGAGG
CTTTTGTCACGAGTCCAGTTCGTTTCTTGGCGTGGGCAATACGCGATGCCTGCATGAAAACATTGGGACGGCAGTGTTCCTGCTCGGGATCATCGTCGTC
ATCTCCATTTGCTTTGACCGTCTCATCCACTACGTGCGCCACGGCATTCACTGCCCGCAGCTGAGTAAGATCGTGAACCGCATCCTACAGGAAGTGATGA
TCATGGGCTTCATTTCGATGGTGATCTTCACGCTCAATACAAGCGGCGCGATGAGGAACATGAGCTTCACGGTAGACAAACTCTCGGCGTCCGAGCAGCT
CCACTTTTATGAATTCTTCCACTACATCGTGTTCCTGACCATGATTTACTTCATTATAATCGTACTGCTGCTGCTCTTCATCGGCACGGTCGTCCCGAAA
CTGATCTGGAACAAGCACAGTTCCCAAGATCTCGAAGAAGAAAGCGAGCATGCGTTTGGTTTGCAGTACAGTGATGAAGAAGAGAATGCGGATTACAACC
GCACGCTCAACGGATCGGAGGACCGGTGGACGCGTGGCGAGTTCCAGTCGACCTCCAGACTGCATGGAAATCGACCGTCGGCGCTGCGACGAATGAAGTC
GGGAATGGATCTGGTCCAGGGATCGCGAGCATACAGTCTCCTGTTGGAGCGCTACCAGCGCGAAGGTTGGTGCTTCCGGTTCAACGCGCTCAAGCAGTGG
CATCTGTGGAAAAGCTTTGAGATCCTGGCGTACAACATTTGCCAGAATCGATCCGGGTACATTTACAAGAACCCAGCCGAGATGGAACGACTGTTTGGCG
TGAAGCCTCCACCAAGCAATCCAAGCAGGTGGCTGCTCCCACAGGAGCATGAAGTCGAGCCCATGACGTACGCCCGGTACCACGTGCTCTGCATGCGCAA
CTTGCTCTTCCATATCACGGATTTGCATGTCAGTGCACTATTTATCCTCGTGGTGATCTCTGTGCTGCCGTCGGTGTACCCGGACTACGATCACTGGATC
TTTATCGGCGTCGGCGGGATTCTGCTCCTCGTGAACCTGGTGATTTTCTTCAAGGTGCTGCAGATCTTACGAGGCATCGTGGACGACCGTCTTCGCGTGA
TCACGATGCGAGATATCCGAATGCGGCTAACAAAGCTTCAGAGCAGTGAGAACAGTAACCTCTCATTAAACGAACTCGAAGCCCCTTTGCAGACTCCAAA
GCGCCTGTCACTGAAAGGCGTGGCGCTGGGAGTGCGTGCCGTGATCCGCATGCAGATGTCGGCGCTTTGCCATCGGCAACTGCATCATCACGATGACCGC
TTTTGGTTCAACAGCCCGCAGTTTTTGCTTCGGCTATTTCAGTTCGCGACGATCAGCCAAGCGTTCTACCTGGTGTGGCTCTCTCTTGTCGAAGCGCCAA
CGATCATGCAAACGGATCGAGGAGCCTATCTTCTGCCGATCATGGTGTTGTTGCCGCTCCTCGCGCTCTGTGTCATCACTCCGATGACGATGCCGAGTCT
GGTACTCGTCATGAGCCTAACAGGCATTTTCGTGGATCTAAACAGTGAAGCCGACAAGCAAGGACGCCGCGAGCCCTACCAGATAGCACAGACTCGAATC
CGACTCATGCGTCGATCGTTCCTGAAAAGCCACCACAATGATGACACGATTGGTTCCTGTCCGCATGTGGCGAGTCCGACCCACGATGAGCACCAAGATA
CTGTGTCCTCGCCGTCCAACGTATTCTTGAGGATTTACGACTCACCTACAGCGGCAGCTGTTCACAGCAAACTGGGACCGGATCTCGTCAGTCCAGTCTC
GTCCCCAATGGCTCCGCGAAGCTCACCGAGGAACAACGAAGATACTTTAACTGCTAACCTCCTGCAAATCCGACGAGGTAGCAGTGGCAGTAGCAGCTCG
CTTGGGAGAAGGAACCGCGACGATAACGGATACAGCGGCCCGCGACGCTCGTTCAATCTCGCAGCATTCCAGTCGTCCGCGACGCCGTCGTCAGTTTTGA
CATCGCTGTACGAGAGCCCTCGCAATAACAACTACTTAGAGAGTCAGCAAGCAGTGCTGCCAAATTGGAGCCACACAAAAGTGGACAGGGTCAACTCAAC
CCAAGAACCAGTAGTGTCACGTACAACGGACGACGTGGCCCCCAACAGCAACAATTCAACCGATCCTTCGCCAAGCCCCGTTTCAGAACCTTTCAAGAGC
TANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGGCGGGTACCCGGATTCATAGGCAAGACTTCGGCCAGGTCTAG