Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-fgenesh-gene-0.18
Orientation:
(+)
Number of Exons:
6
Description :
HECT E3 ubiquitin ligase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-108
NN-scoreoddsWeighted Score
0.8634.8740.01
*** None ***
TypeScore
nuclear565
GO
*** None ***
*** None ***
*** None ***
Sequence
        2028 bases(100 bases per row)
ATGTGCGGCACGAGCTCCGGGTTTCTCATGACGTCGGCGTTGGTGCGTCACAAGAGCTCCGGCACGCTGCTCAAGAACGATGAGAGTGTAGACGATCAGG
AGAAGGTACGTGCGCGCCAACGCGCGTTGTTCAAGCGTCGCATGAACTCAATGTCGATGCGCAAGGACCTCTCGCAGCGCCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCGGCGCCTCTGGGAACGGAAGCAGGACGCCGACGGTAAGTTCCACTGGATCCGACAGAACAGCATCGACACCTTCAACGACA
CGGCGCTGTCGGGCAACTCGATGATCCTCACGAACAGCAACCGCGGCGCCGCCGGGAGCTTTCACGGCACGCAGGTCAAGGGCCCGCTCGAGAGCATGAC
AGACTACCACAACCTGCGCTCGCAGGGCTTTGTGTGGCAGTACGACGACCTCGGACGCCTCGTCTGGAAGCAAGCCGAAGATGGTAAGCATTTCAGTGCT
GCTCCTTCTTTTTCTTGTAGAGACGTGCCCTCATTGTATGTGTATTTTATGCAAAACAGTCGCAATCGACATGGAATCCTTTGGAAGGATGAACGAGGGC
AAGGAAAAAGCCATTGACTTTGAGGTGAGCTCTTGGCCATATACAAAAGAAGATATGTTGGTATGCTTATTTGATGCTCATTTGTATGTGAATGTTTTAT
TGTTTTCTTTTTTCTTTTCTTTTGTAGGGTATCATGGCGATGGACTTTCGTGTCAAGAAGCAGTGGTTTCTCGTACACTTGGCGCAGATCGCGACGCCTG
TGACCAAAGCTGTCTCGAAGCTTGGTGCGTATCCTTTACTCATATTTGTTTCTGCTATTGCTTAGACGCTCTCAACTAACGTTTTGTATTTGTCCGCTGC
TCCATTACAGCTGTGACGCGTGAAAACCTTGTGCAAGAGACGCTCATGCGCCTCACGACGGCGTCTCCGGAAGCGCTGCACACGTACCTCAAGATCACGT
TTGCGGGGGAACCGGGCATCGACGCTGGCGGTCTCTTGCGTGAATGGTTTGGCATCATCTGCAAAGAGATCTTCAGCGAGAAGATGGGGCTGTTTATCCC
CACCAAGGGGGAAGACATGAGTTACTGGATCGATCCGCTCTCGGGCGAGAAGAACAAGAACCACTTGCAGTACTTCCGGTTGGCGGGTATTCTCATCGGC
AAGGCGCTCTTCGAAGGCCTTGTGCTCGACGTTCACTTGGCGCTACCGCTGCTCAAGCACGTGCTGGGCATCCCGATCTCGTTCTCCGACTTGGAATTCC
TCGACGAAGATCTTCACCGCAACAGCAAGTGGCTCAAAACGAACACGCAGGTGGAAAACCTGTGCTTGACATTCAGCATCATGATGGAGAACGGCAAAGA
AGTGGATCTCAAGGAAAATGGACGCAACATTGACGTTACGGACGAGAATAAGGACGAGTATCTCCGCTTAGTGCTCGAGTACCGCATGCTCATGAGCATT
GCGGACCAGCTCCAGGAATTCCTGTCGGGGATCTACGACGTCGTGCCCAAGGGCTTGCTCTCTGTGTTTGATTATCAGGAGCTAGAGTTGATCCTGTGTG
GCATCCCGACGATTGACACTGCGGATTGGAAAGCGAACACCAAGGTGCGGTACTATGTCGCCGACGACGAAGACCGCAAGCGTGGCGCTCCTGTCATCTC
GGAAGAGGCACAGAACTCGGTCTTGACCTGGTTCTGGATCGTCTTGGAGAGTTTCACGCCTGAGGAACGCGCGCGGCTGCTGCAGTTCACGACCGGCACG
AGTCGCGTGCCTGTGGAAGGCTTCAAAGGGTTGATGAGCTCGAGCGGCATCATCCACCCGTTCACGATTCAGTTGATCAAACGCGGGAACGACACGTCGG
ATCTGTTCCCGAAGGCGCACACATGCTTCAACCGGTTGGATCTCCCGTTGTACCGCTCCATGGACGAAATGGAGACGTATTTAACGATGGTGTCCCAGAT
GGAGATCATTGGCTTTGGCTTGGAGTAA