Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.47
Orientation:
(+)
Number of Exons:
2
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-113
NN-scoreoddsWeighted Score
0.793.2930.007
*** None ***
TypeScore
nuclear304
GO
*** None ***
*** None ***
*** None ***
Sequence
        644 bases(100 bases per row)
ATGACAGCAGCAGCGCCAATACAGTTGATCAATGCGATCTCCGCAGTCGATGCAGTGGAGACGACGGCGCAGAACGAAGGACAGCGCGCTCTTTTGGATC
AAGAAACTGCAGCTCCAAAAGCAGAGAGCGGGATCAATGAAGAGCCGAAAGCAGCAGCCAGCGCGCTGGAAGTGACGCAGACGACGACAGCACAGGAGCA
ACCGCAGCAGCAGGAGAAAGAAGAAGATGCAGCGACGCTGGTGGTGTCGAATGCGACGGCAACGAATCAGCGGCCTGCGATAGGCTCGGGCATCGTGGGT
CTGGAAATAGCCGCGATCCTCGTGGCGTCGGCGACGGTGGTGACAATGGTGGNNNNNNNNNNNNNNNNNNNNGCGAGTGCTATCTGCCAAGAAGCGCAAT
GAAGGTACATACACACAAACGCAACAGTCCGCATTATGTTTTTTCGTCGTCATATTAATGATTTTATGTTTGCTTCTAAACTCTATGCAGAAGTCAAAAA
CCAAATGCTGATGCAAGACCTGCTGTACAATGACATGGACTACGCGGCAATGTAGCAGCATCTTTGCTCGCATATAGGTTTCGCACGCAGACACACACAT
GTTATGCGTTTGCAATATAAATATATGGATTCGTTTCTCCACCA