Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-1.15
Orientation:
(-)
Number of Exons:
1
Description :
Phosphatidylinositol kinase (PIK-L4)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1970
*** None ***
PositionContextScore
394SRKRTRR|GS0.654
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        5910 bases(100 bases per row)
ATGCTGTTTTACATGGTATCGTTTTTCTCGAACGAAAATCTACGCGATGCCCAAGACAGCGTATTGGATGTGATCCTTCAAATGGCGTTGTTTCTTGAGC
AAAATGACGTGTATGGATTTGTGCATTTCTTCCGTGATACTGTCGAAGTGCTGCAAGATTGCTTCTTGCTGGAAGAGTCGCTGAAGAATCGCGAAGGCGA
CCCTAGCTTCGCGGGTGCGAGTATTGCTTCGTATCTCGATACAGCCATCCATCTCTACCAAGACGCAGATGGTCCGCTGGGTTCGAAAAGCGCAACAATG
CTTTGTGGCTGTGAGTATGTCGCTGATGAAACCAAGATATACGAACGGAAGCAGCAGCTGAAAAAAATGCTTCCACCCATTCACGTTCACTCGTACAGCA
ACTCGATCGCACTACGAAGGTCTATGCTAACCTTAGCCAAGCGACTCATTCTGGAAAGCAATGCGGTGGTTACAAACGATACCGCGTTCAACAAAGTGCT
TCAGTTGGCAAGGCTCTTCATGGAGAAAGATAGCGCGCTGCTGAAGGATTTTCGAGGTGTAACCGGTGAAACTCGTGTGTCAAAGCAAGAGACGTTGGAA
GTCGCTCAAGCTACACATGGTCTGCTTCAAGCCATGCTCCACGTCACAACATCAACAGAGAGGAAGTTTGTTCGATTGGTTTTGACGTTTTATGAAGTCG
GCTCATTTGATCCTACGGAAGCTGATTTGATCAAACCTATTGCTTTGGTGCTAAAGGGAATTCGAGATGGTCAGCATCACATCTCCAAGTTTGCCGCTGA
GACGCTATGGCCAGCACTAAGTGATTGGGTTTTTCGAAATATGTTTCGCATGGAGGATTCGGACCGAATTCCGATTGATTTTAGTACCCGTGAACGTCAC
AAGATTTGGAGCCTTGCTTTGGAAATTGTCGCAATCTACCTGCGGCGCTCGACAACTTCGTCCCCAGTGTCTCTGTTCGTGAATCTCCTTGGATGTGTTG
ACGTCACTACGCTCGAAAGACCCATGCAGTCAGCTGTAGTTGCGTACGTGCACTATATCCTCTCTTCAAGACCTTTACTCTCTCAGTTTTCGCATTTCCT
GGCGAAATCTCTTGTGACGAACAGCTTCGAGCTGAATGCAGATGGACGTGTTGGCAGCAAAAGCCGAAAGCGGACACGAAGAGGGTCGTTTGTTGGCTCA
TCTCGACAGCCCCCTCCACCAGCATATGCGTCTCATGGGGATCATCGTTCAGCAGAGCTAGAAGTTTGTGAGAACCTGGGTCGATGGGTTTGGGATCTTC
TCTTTTACGGCTCTGAGAACGGCACCAACGAAGTCACGGCCTTATCGCTTGCGATGCGGATTATATCCCCGTTTCGAGATTTGATTACGAGTATGATGCG
AGCTGAGAGCTACTCAATTTTCCGCGTGCTGCTTCAAAGAGTCGATTCAGTGATGAACAGCTTCACGTCATCTACTACAGTTGTTACCGAAGAATGTGTG
GACTTTCTCATCACAATGCTTCAACACTTCGAGGACTTCGACATTGGGAAGTATGGGCTAGCATTTAAGAGTGTTCTCTCGACGATTGAGTCCATGCGGT
ATTTTGCTGAAGATGATACGATGAGTGAAGAGAGGCCGTGGAATAGAGAATCATGGAAGCAACTTATTTCGATGTTGCTTCACCATTGCAAGCCAAGAGT
CCAAGATTTTGACAGCGATGTGTCCCAAGACAGTGTATTCGCTGTTATCCACAAGATGGATCTGGTGTCTACAATATTTCAGCAAAGAAACTTGTGTTTA
CGTGCAGTATTTTTGGTGCACTTTTCGTGGTCGAGATCGAAAGCGCTGAAAATGACTCAAGAATCGTTATGGCAAGACACCGCACTATGGCAAATCATTT
CTCGCTCAATACTAGATGAGCGAAATCCGCAGAGTGTCGCATGTGCGTCAGTTGCCATGTCCCCTCTTCTTGCAGCTCTCCTGAGTAGGGATTGTGAATC
ACCAGACAAGGTTGTCACGAGTTTGCTGGAACTGTTCGTGTCCAAGATTCAAGCTGGTGCATCAGATTTTCTGCTTTGTTTTGTGTTGGAGGCGGTCAGT
TCCATACTTTGTATCACCTCAACTCCTTATGTCGACGTCGAGGGCGATTTGATAAACAAGGAACAGATGATGGCGCAAACTTTTGGATCACCATCTTCGG
TATCAAGCACCGCAAGACGCAACTTTTGTCAATGTCTGCAGCATGGCGCCAAGACCAAAACGATCGCTATTCCAGCTCATATTGAATCAGTGATACCGGA
GGGTCTGATCACCCGCTCTGAAACGATCCGTCTGAAGTCTGCATCATGCCTAGCATCTGTCTTGCGGCATTGTGATCTACACCCCAGCAACTACAAGTTG
TTGTCTCGCTTTAGCGAGATTGTAACAAGCACCTTGACCATCGGAGACTCGTCAAGCCGTCAGACAATTTCAGAGTTATTTGGCAGTTTAACGGGCCGTC
CAATGTTTTTTCAGATGCTCATCTTCCCAGTGAAATCAGACGACAATGTTGACTTTATCGAGAAGATGGACCTTTTGCTTGCAGATGCCGAAGAAAATCT
GACTGTCCAAGTGCTGCTTTCCGTCATTCCACTGCTTGGAGCTGTCGGATTTGCGTGTGATACTGGCAGTACTGAGCAAGTGGAAGTGCTCATTTGGGTG
ATGCTTCGGTTGGTTTCCATTTGGAGCAAGACGCACGTTAAGAAGCTGAGTCTGTGTGTGGTATCTGCACACGATCAAATTGCTCGAATCACTGCACATC
ATCAAGTTTCATGGCGAAGGCTATGTGTAGAGTACCCTGAGTTGTGTTACTACCCCCTTGTTGACGAGCTGATGGTGTCTGGCAACATTCAATTGTTCCT
TCGAACATTCATGGGTTCAGCAGTGGATGCGACGGCGTTTTTACTCGCCAGTGCCAGATATGTTTTACCGACATACGTTGTTGATCGGAATGATACGATG
CTCCAGAAGTTCATCACGGAAGTTAACGGAACGGACGATGAAAGATCTGCGTACGAAGATGGGTCCGAGGGCGACGATTTCAGGAATACAACGATTGCAG
ACATATTGCTCAACCACATCGAGTACGTGCTGAAGGAAATGATAATTCATCAAGTTCAAGTGGACAACAACGAGAATCGTCTTGCCGAGTGGGACTTCCT
GTTCAAGTTTTTGCCAGAGAATATGACTATCGGTGACATCATATCTCATTCTCCGCTGCGTCTACTGAACTTGTTGTCGTGGGAGCTGGGTGGTCCGCGA
TTCGAGTTGGCAAAAAAGGCATTTCGTGAGATCTCGCAGTACCTTAATCGAGACAAAGGAAATGACGCAAATAACAGCGTGGGATCTGGCGGCTTGTTGA
TGCCACGTCAGTATTTTCTGGCAATTATGACAGATTTGGGTAATAAAATCAGTGGTACAAGCTCGAGTTCTACTGCAAGCAAGATTCAAGCGATCAAAAG
CATCAAGCGTCTATTCAGTCTGTTCAAATCGTCTGCTGTCGTCGATTCGGAAAATGCGAGCAGCAATGGAATTGTCGACCCATTTGTTCCTAAGGTTATG
GCAACTTTGAAGATTGGGCTTGTAGAGGGCGAACTACAAGAGCATGCAATGAACGCCTGGGCAACCTTCTTACGGATGCTTTCAGTTAAAGCATTGGAGG
CAAACTTCTGTTCGATCGTCGTCAGCCTGCTTCCCTGCATAGGGTATGATCCAGCCATGATTTTGCAAGAGAGCGTCCGAGTTCGCACAGGGCACTGCTG
GAATGTCGATGTATTGCAGAAAATGCTGCCATCCGAAGCAGATACACCAATGTCTAGTCCAGAAGAGACAAAGCATGAAGCGAGTAAAAATACTGGCTCT
GCAATGTCTATGGCACTGGATATTCTGAAATATTTATTTATTGAGAAGCGCAACGAGCTCAAACAAGCATTCCCACGAATCCCTTTGCTTCCCTCCATCC
CCGAGCTTGACGAAATTTACATCGTGTTGGAAGCGGACGTTGGAGACCCTGAACACAAACCATTGGGCGACTATTTGACGGACTTGGCGTCATACGTAAA
CCATTGGGATATGGCAGTTCGTGAGATGGCGCTGACACAACTCCTCCGATGCTTGGTTGTTCGAGGACGAGAGCTCCAAGCACTCCTGGAAAATGAAGGC
GATCTTTTCGTGGACAAAGCTATCGTAGATATCATTCTATCTGTTTTGCAGCTTGCACGAACAGAAAGTCAAGAAATCGTGAAGCTACTGTGCGCGAGAT
GCTTGGGTGCCCTTGGCGCGATTGATTCAGCCCGGATGCCTCTGAGTATGCTCTACGAGTCTGGTTCAAGCCAAGGTGGAATAGTGGCGAAAGATAGATC
CGAGCAACGTGCTGAATACTCTACCAAAGATTTGGCGTGCGTGTTGATCGAGACTTGGCTAGTGAAAGAATTACGGGCTGCTCCCGAGAATACGGATTCC
GTTGCCTTCGCCATCCAAGAACTCTTGAAATTCTTAGCGGAATTGACTGCAGATCCTCAGCACAGCGGCCAGAGTTTGCCGTCGACTGGCGTTACGATCT
ATCAGAGACCTAAATCAACTGATATTCCGATCATGCCTGAGTGGATGAAACGTAGGTTCGAGAGAAAAGATGTGCTTCAGTTTGTGGAGCCATATTGGCT
GACACATTACTCGGTGTCGAGCGATTCTTCGAAGAGTTGCAATGGTGCCAAGGGTGACGGAACGGGCGATATACATCCAGCCCTCGATGATATCACTTAT
TACGAGAAGCACGGGACATCGTACGAAGACTGGCTACTGGCGTGGTGCAGACGACTGATCGATCTATCCCAACCACCAGAGCGGAAGATTTTCTTGGCTT
GCCGAACTGCATTGCCTACGTGCCCACAGATTGCAAGGTTCTTACTTCCTTATCTAATGCAGAATGTGTTGCGCTCCGGAAAGCCAGAATTGTATGGAGA
ACTGAAGCGGGAAGTTATGGCTGTCTTGAATGATCGAGATCGAGGAATCATGGCAGACGAGTATATGATTCCAATTGAAGGAATCCATCCGGTGGGATCA
ATATCGTCTGGCAAAGGACCCAGCAGCCATGTAGAAGAGAAGTCATTCGGTGAAGAATCAAGCCGGCATCATCAATGCTCACAAACCATTTTCTCGACTA
TTGAAGAGTTAAATGAGTGGGTATGGAGCAGCGAAAAGAAGAGGTTGGCGTTGAGTGGAAGCGCAAGTCGTCAAACAGCAGGGTCAGCAAGGTCTGTCGA
CATCCCCTCCGAGCTAGACGATCAAGAAAAAGAAAATCTTGAAGAATTTCTGAAAGATATCCCGAGTGAGTCGCTGTCAAATGCAGCGTATGGGATCGAA
GCGTATGCACGCGCAATTCAATACTTTGAAGTTCACTTGCGTCAGCAAGACTACAAGCCTGCGAATGGGAGGGAGTCCAGCAGCAGCAGCAGCTACTCGA
TGTGGCCAATTCATCTTGCTCTTGTGTCGAAGAATGCTTTCTACCTCCAGCAACTGTATAAAAGTGTGGATGAGCCCGATGCTCTCATAGGGCTTGCCAC
TTTACGCAGACTGTACGAAGCACAGAGACATAATGAAGGTGACAGCGGAGACCCTCGACTAGGAGATCGAGAGGACGGGCTTAATTTGACCGAATTGATG
CATCAAGTTGTAGATCATGAGCAGCTAGCGCAGTGGGAGGATGCGTTGGCATGCTATGAGCAAGCTATCCAGGAAATACAAACCGCGCTGTCGTCAAGAG
CGTTCTTCTCGACGGGATCTCAGATTAGCAAGCGTAGAAGTCAACTCCCACGCGGCCTCATTGCCGATCCTCATGCAGATCCGGAGCTGGTGAAACCTGA
ATTATACTCT