Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.50
Orientation:
(+)
Number of Exons:
4
Description :
Function: when the human ATA1 cDNA is expressed heterologously in mammalian cells
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2
68-104
150-212
273-273
26-44
128-131
236-254
3-25
45-67
105-127
132-149
213-235
255-272
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1564 bases(100 bases per row)
ATGACGATCTTCATGGTGCTCTTCGTTGGAGTCGCGTCGTACTGGGCCAGTTCCTGTCTGGTTCGCTTGGGTGTCGACCATGGGATCTACTCGTTCCAGG
GCCTCGCGCAGCTCGCGTTTGGGTTCCGCGGCGCATTTGTTGTCGCTGCCGCGCAATTCCTTGTGTCGCTGGGACTCATTCTCACGTACTTGACAATCAT
CTTCCAAGACTTCCCAGTGCTCCTGGGACACTCGCTCCACTTGGATTTTGACGCAAACGGCTGGCCCATGGAAACCGACAACAGTTTCGCATCCAAGATT
CTGGCCGATCGCACTCTATTCGCTGAGCTCATTGTACGTTTCCGCTGTGGTCTTCGCTCTCACCGCCAACACAAGCTAACTAACTCTGCGTTTGCTTTTT
TTGTGACCTGACAATGATGCTTTCTGTAGTCGTTCATCGTAGTGATCCCGATGTGCTTGTTTCTCTATTCCTACCGGAAGATGCAAAACTGGACCGTGGT
GATGACGTTTCTGCTGGTCATCGCATCGCTGTGTGCGGTCGGCAAAGCAAGATCCTACCATAACAGTAACACTCCGACAATGTCCCAGGGGTTTACGAGA
GACTACGTGGCAGTGCCGTCCACGCTGTGCCAGGCATTTGGGATCCTATCAACGCAATTCGCGTGCCAGCACCACACGTTCCACACGTTCTACGCGTTGA
GAAACCGGTCGATCGCGCTGTTTTCGCGCATCTCGCTGTTTGCGAGCCTACTGGTGCTCTACTTGGCATTAAGTTTTGGCATTGGCGGCTATGTGTCGTT
CCTTGGTGCTACGAAACCTGATGTGACTCAAAACTACGACTTTGAAGCAAACCGGTCGATGCTGCCGTTCTGGCTTTTCTTGCCTGTGTGCGCCATGATC
TGCATCCCGATGGAGGTAAGAGCCACACTCATTTTCTTCTCTTGCTTGAGAAAAAACTCATCCAGTTCTGTATTTCTGCAGGTGATTTCGTCGCGATTCA
CTGTGTTGCAGCTCGCTCGCGCGACCGCAGACCACGATTTGGCCCCAGAAGAAGCACTTTTCCGCGCGCAACCGGAAGGAAAGCAATATGAGGCTACCAG
TGACTCCGATCCAAATACCTCATCGCTTGAGCACAAGACGGTGCAATGCGGTGAAGATGCCTCGTACACGCGCATCCATGTCGTCATCACCTTTGTGCTG
CTCGTGATCCTCGTTCAGATTGTCGCCCTCAGCTCTCCTCTTGATCTTGGCAACGTCCTGAGTGTCACTGGTGGACTCGCAGGGATCGCACTCATCTTTG
TCTTTCCTGCTGCGTGCTACCTGAAATTGCCAGTGAGCGACGACCGTCGAGTGGGCGAGATCGCCGCTCGNNNNNNNNNNNNNNNNNNNNNCGAGTCTAC
ACGAAATACGTCCCATGGGCCAGCATTATTGTCGGGATTGTAGCTGCGATTGCGTGCATCATCGCCAACGTGGCGTAATCGTGGCTGCCTGGGGTTTCGA
CGCTCGTTTCTGCCCGCTTTGTTTGCTTCATTAGTTCGAATTCTTCTTGCCACTACTCGTTTGA