Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.45
Orientation:
(+)
Number of Exons:
2
Description :
Zinc finger (C2H2 type) protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-57
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        522 bases(100 bases per row)
ATGGGCAAGAAAAAGCGTCGCGACGATGGCGCCGAAGGCGGCAGCGGTGCGGGTGGTGGTGCGCAGACGTCGGCCTCCAAGAACCGCATCTTCTGTTACT
ACTGCGACCGTACCTTCGAGGACGAGAAAGTACTGATCCTGCACCAGAAGGCGCGCCATTTCAAGTGCCACGTCTGCCACAAGAAGCTCAGCACCGCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAACCTGGGCGGGAGACGGTCGATA
TCGAGATTTACGGCATGGAAGGTGTCCCGGTCGAAGGCAGCACAGCAGGTGCGTGCTAATTTGTATCTTGTGGCATATTATGTGGACTTTGATGCGCGAC
TACGTTCTTGTTGTATTTTGGTGCATTATGCGTGTACTGACATGACTGTCGCTTTGTGCACTGAATGTGTATAGATTTTAAAAAACCGCGATTGGATGGA
ATGCCTCCGCCGTCGGGCATGA