Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.76
Orientation:
(-)
Number of Exons:
2
Description :
MMS2
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8270.88426
InsideOutsideTMhelix
1-897
NN-scoreoddsWeighted Score
0.7683.870.008
PositionContextScore
224SPRRSSR|FL0.662
277SNAPLRR|SA0.535
306LLPRTRR|CA0.544
415GRSRAAR|NR0.684
506VLRRQAR|SG0.589
614RGERKRR|CV0.668
786YPIRRKR|FD0.647
TypeScore
nuclear913
GO
*** None ***
*** None ***
*** None ***
Sequence
        2928 bases(100 bases per row)
ATGCCTCGAGTCCTCCATGTTACTCGGGTTGCTGCGTTGTTCGTGCTTCTCATTGTAGTGCTCTGCGTGTATGGAGATTGGCACCGCGTCGCACACGAGG
TGCCATTACAGCAACTCCTCACAAAGTCATTCAGGCACGTTTATCGAGACACTTTCAATAAGCCTGGCTGGCGGTCAATGGACTTTCTAACGTGATTTCT
TTTGTATTGTTGGTGGAAACTTCGTATCTATTTCAGAGCGCTAGAGAATCTCAATGCCCCCGTCGAAGCGATATCGTCGTCGCAATTTTTCCAGAAGCTA
CCGAGACAACAACAAGGTCAACTACTCGAGGAACTCGGACGCTTGTACCTCTATGGAAGCAATTATGCTGGTGCAAGCAGCAATTTGCCAGTTCTAAAGC
CAAACCTCACGAGAGCGTCTGAGTACTTGCACGCGAGCGCCAACCAATTCGGGACCTCGAGAGCGCAGTTTCTTCTCGCTGCGCTCTCCACGTTCAGTGC
ACGCGATAACAACCTTTTTCATGGCAACGATGCTGAGACCATCCTGTACCATCACTTTGGCGCCCGGGGTGGCTCGGTCGCGTCATCGATGGCCCTCGCG
TATCGCCATCTCCGTGGCGATGGGGTCCAGAAATCCTGCAACGCGGCGCTCAAGCACTACAAGTTTGCAGCTGACCGCGTGAAATCGGCGCACGCTGCGA
GGACACGCTACCCGATCCAGATGTTCACTAACCAGAGACCCTTTCGTCTGTCCAACAATGCACGCAGCAAACCGCCCTGTGAGCAGGATGATGCGCATCG
AATGGAGTACCTGAAGCAGCGAGCGCGGAGGTCCTCAGACCCAGTCCTTCTGGAGAATGCGGCGAGCGTCGTGCTCTTCAGCGACTTTCCCCACGGAGAA
GCAGTCGATTCCTTGGACCAGCACCAGATGCTGGAGGCAAAGGCCTTCCTGGAGCGTGCGATTCAGCTCGGAAGCTTCTCAGCCAAAGCCTTGCTCGCCC
ACGTTTACGCATACGGGATTCGTGGGTTCCCACAAGATGTCGCGGAAGCAATGCGCCTCTACGAAGAAGCGCTGAACGAGTCTTCAATTGCGAACAAACC
AAACGCAGAAGCTGCAAATGGGCTCGGCCTCGTCTACTTCCACGGACTCGGCGATGTTGATGTGGACTACGAGCGCGCCATGCGGTTGTTCCAAGTCTCT
GCAAGAAGTGGTCATGCCGACGGCGTGTACAACACCGGGCTTTTGCTCTCGCAGTCCCATCCTCAGCGTGCTCAAGACTACCTGGAGGCGTCAGCAAACG
TCGGCCACCTCCCAGCTACGTTCAAGCTCGCGCGACTCAAGGAACGAGCACGACTGCGCTCGTCGCTTTTCAGTGCAGGAACATCGCACGATGCAGTCGC
TGAAGCGAGCTCTTGTGAAGAAATCGTGAAGTTGTACAAGAAGGTCGCAGAGCAGTCGGAGGAAGGTCTAGAGCTGCTCGCAACCGCGACGGCGGCCTTT
CTCAACGGAGACCGTGAGCATGCGCTGAAACTGTACTTGATCGCCGCCGAGATGGGATACGAAGTCGCTGAGAGCAACGCCGCATGGCTCCTGGAGCACC
CGGGGTTCTCGCAATGGCTGTTTCACGAGAACCAGTCAAATGTCTCGGTGGGAACTCGAATGTACCGCCGACTCGTTCTCCGTGGCGTCGCCCAAGAAAG
CATCGATGCCTCCGTCCGCTACGGCGATTTGCTGTTCTACGAAGGCAAGCACGCTCTGGCGATGATGCAGTATGAGCGTGCAGACGAAATGAGCAACGGG
AAACACGCTCGTGCGCTCTTCAGCATCGGGTATATGCACGAGCATGGCCTCGGGATGGCAACGCGATCGCTGGAGAAAGCGAGTCTCTACTATGAACTCG
TGCGCTCGACCGAGCCATCGCTGTACTACGTGATGACGCTGTTGAAGTGCAAGCTGTCGATGCAAATGCGTCTCGAAGCGCTAGTCTCGGCCGTGAGAGG
AACGCTAACACAGCGGCCGGCTTATCACTTCGAGAGACCCAAAGTCAGCACCGAAAGCGTGGAGAAAGGAAACGGAGGTGCGTCGCCTTCTGCGGTTGCT
GACACAGCAGCACGAAACGCGATTGCTCACTACAACCGAGTCGCGTTTGCATCAGCACTTGAATTCGGCTCGGATTCCAAATTGCAATTTGAAATCCGTG
CACAATCGCGGACGCCGACGGCATTGACGATCGAAATGTGGATCAACATCCTGCCCGACAACTCCGCGAACGAACTCAGTCGAACTCACATGGTGCTGCT
GGATTGGCAAGACTCGCATCAACTGGAACTCGTCCGAGGCCACCAAGAGAGCTCCTGGCGCGTCCGCTTTCGCACACAGTCTCTGGTCATTGACTTTCCG
CGTAGACACATTCACCCAGGAGAATGGGCTCATGTCGCTGTTGCTACTGCCAGCAATGACGCAGGATTGCTTAGCAGTACGTTGTTCGTGAGTGGTCTCG
TTGCGGACCACAGGGAATTCCGTTTGCCTCAATCTGGTGAGCAACCACCCAATCTCATAGCCAGTGAAGCACGTATCCTATCCGTCGGAAGCGGTTTGAC
GCGATCCACAGAGGCAACTCCCACACATTTTGCTGGTCGAATCATGAATGCGCGCATTTGGCAAACTTCGGCACCGCCATTGCCCATAGCGACGCTCATG
CATACGCCAGAGCACGAAGTACCAGCACCAGAGCTCCTGCTCGTGCAACTGCAGCTTGACCTTCGGACCGAGCGAGAGACAATGGCGAATGAGCATCAAA
AGACCAGCGTCGCGTTTCTCGAACGCGTCAATCCGCAAAACGAAGCGATTCACGCCGTACGGAAGAACGAGCACGTGCGGCTGGCAATCGAGCGGTTCCC
ACCAAAGACCAAGGACTCGGATTCCTGA