/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_dbe39d0453534c86a0e0a2adf09deba2 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1223559 -w 120 -web -o /tmp/images/bd_log_output_file_dbe39d0453534c86a0e0a2adf09deba2
Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-1.16
Orientation:
(-)
Number of Exons:
1
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-65
NN-scoreoddsWeighted Score
0.8965.8160.012
*** None ***
TypeScore
nuclear652
GO
*** None ***
*** None ***
*** None ***
Sequence
        258 bases(100 bases per row)
CGGCAGCACGACGACCCGCAGTACGACTCGACCACCCCCGCAGCCATCCAGCGGTGCAAGACCATGCTCTCCAAACTGAAGAAGCTGCTCCCGAAGCTCA
TGCGCCCGATCCCGAGTGTCTCTGTAGACGTGGGAGTTCTGATGCTGCGAGATTTGTGCGAAATCGTCGAACTGCTCTTGCGCGGATCGATGTGTCCGCA
CTCGATGATGCTGTTCATGGACGGAAGTGCCAGACCTACCACGAGCTCACTCAATGGT