Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.55
Orientation:
(+)
Number of Exons:
3
Description :
CDS Pa_3_8760
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-75
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        581 bases(100 bases per row)
ATGTCGCTCCAGGATTTCGAGAAGCTCGGACTTCTCGGCATGGGGGGCGCTGCGATCGTGTACCTCGTGCGCCATCACGCGAGCCGAGCGCTGTACGCGA
TGAAAGTGCAGCAGATTGCGCGGTCCGACCCGAAAAATCGTCAGGTGCGTTAGCCTCAGTTGTCTGCTGAGTGGTGTGTGTGGCCATTTTCACTCGTCTC
CGGTACGTTCTGATCATAGTTTGCGTGTGTGGGAGGGCAGACCCAACGAGCCCTCAAGGAGCAGCAGATCTTCGAAGCTCTGCAGCACCCGTTCGTTGTG
CGCCTTCACTTTGCTTTTGAGGTACGTACATTCGAGAGCTTCCCTTGAGAACACGATCTTTTCAGATAAAGCTAATTTTCGTGTTGCAGGATGGCGAGAA
TCTCTGCCTCGTGATGGAGTTCTGCGAAGGCGGGAGTCTGAAAGACCTGCAAGAGTTTTGCGGCGGCGCACTCTCGGAACACGAAGCGCTGTTCTACGCT
GCAGAAGTCGTCATTGCACTTGAGTATGTACACACGATGGGCGTTGTGTATCGCGACCTGAAGCCAGAGGTGCGTTACTGA