Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.51
Orientation:
(+)
Number of Exons:
2
Description :
Oxidoreductase, 2OG-Fe(II) oxygenase family family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-99
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        938 bases(100 bases per row)
ATGGCAAACCAAAACGACAAGCGCGCGCTCGAGGATGAGATCGACGTGTCGTCGTCAGCCTGCTCAGAGTCCGTTGCGCCGAAGAAGCAGCGCGCGAGCA
CCACAGACCAGAAGCACAGCGTCATCCGCAGTAGCAGTTCTACCAGCCATCTATCACAAGCGTTTACGTGCGAAAACGTGGTTGCTCATGCAAGACAGGT
GACGGCATCTATCTCCAAAGAAATCGACGTCGATAAAGTGTTTGCGGACGCGAAAGTTCACTATCTCACGCGTGACCGCGCGAGTTGGGTGTACCACGTA
CCTCGCTGNNNNNNNNNNNNNNNNNNNNCTGGTATCGCCGCATGTACACCTTCTGTGATGACGACCGCCATGGTTCATACAGGGAGTGGCTGGGTCGCAT
CTGGACGTTGCATCCAGTAGATCATGGCACGATCAAGATGTTTGGCCGCGACGTCCTCACGCCACGTTTTCAGCAAGCGTACGGAGTGAGCTATCGATTC
TCAGGCAACACGTTTCAAGCAGTTCCTGTTCCAGAATCGCTCCAGCACTGCGTGGAGTTGATGCAAGCGATGGTCATGAACCCAGCCACCGACAGCACGC
TTCTCAACGGCATTCTGTTGAATTGGTACGCGGACGGAGACCACTATATCGGCCCTCACTCTGATAGTGTGGGGGCCTTGTACAAGCACTCACCAGTGTT
TTCGCTCTCGCTCGGCGCGACGCGAAGATTTGTGTTTACGGCCAAGACAGGCAAGTCGAGCGCAGGCAATGACAGAAACGGAGCCGTCCAGCGACTGGAA
CTTGCTCTCCAGAGCGGCGATTTGGTAGTTATGGGTGGCACGACGCAGCAAACGCATAAGCACGCACTACCAAAGATGAAGAGTTGCATCGAGAAACGCG
TGAGCATCACACTGCGGTGCTTCGTCACGCCATCCTAG