Transcript Name :
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_1-abinit-gene-0.155
Orientation:
(-)
Number of Exons:
4
Description :
Translocation protein SEC63
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1916 bases(100 bases per row)
ATGCTCGAGTACGACAACTCAGCGTTCTACTACTTTTCCATCTCGCTCGGCGTGCTCTATGTGGTGCCGGCCACGTACCTGTCGCTGCGCCGCATCGTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCAAGGACCGCCTCATCGACCGCCAGAACATCCGCTGCGACCGCGAGCTGCGCAAGATGAAGCAGCTGC
AGGCCGAGAAGACCAAGTTCTCGAACGTGTTCTCGCCGCTCTTTCTGCTCAACCTCGTTGTGCTCGCAGGTCTCTGGTACGGACTCTACCAGATGGCCAT
CTTACTCAAGGACGACTCGGAGATCAAGTCGTTTGACCCGTTTGCGATCCTAGGCATCGCAGCCGGCGCCTCGGAGCGCGAGATCAAGCGCGCCTACCGC
AAGATGAGTCTGATTTACCACCCAGACAAGAACATTGGCGATGCTGTCGCTGAACAGAAGTTTATGCTCGTTGCCAAGGCGTACGAAGCGCTGACGGATG
AAGTTGCCAAGGCCAACTACGAGAAATTTGGCAACCCGGATGGTCGTCAGGCGCTGCAACTGTCCATTGGTCTACCGACGTTCCTATTGGACCCTGCGAA
CCACAACATTGTGCTCTTCTTGTACTTGATCATCTTGGTCGTTGCGATCCCATCGTGCGTGGCGCTCTGGTACTCGCACTCGAAGAAGTATGGTGACAGC
ATGATCATGTACGACACGTACGGATTCTACAACTTTGCGATGTCGGAGCACGCGCACCCACGCATGCTGCCAGAAGTGCTCGCCGGCTCGGCGGAATTCC
GTGAGATCCCAAAGCGCGCGTCGGACGACGCAGAATTGGGTGCGCTCTTCCGTAAGTTTAAGCAGCAGGATTTGATCTCGAAGCCAAAGTACAACCATCC
ATCGATTGCCAAGGCGAACATCCTCATCCACGCACACTTCTTACGTGAAAAGCTGAGTCCGGCGTTGACGGGTGACTTGCACGCGATGCTGAAGAAGGCG
ATCCAATTGGTGGACGGCATGCTCGAGATCTCGGTCGGCAAGTCGTGGCTGCAGACGACGCTGAACTTGATTGAAATGGAGCAATTCCTCACGCAGGCGT
TGTTCTTTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCAATTGCCGCACTTCACGGAGAACGAAGTGCGCCACATCCTCACGGGCAAGAACGCT
GTGCGCAGCATGCACCAGTACGTCGATATGGACCCGAAGGACCGCAAGGGCTTGAACGACTTGAACGACGAACAGAAGGCTGAAGTCAACAAGGTGCTGG
AAATGATGCCGAACGTGGAGCTCAACATCACAATCGCGGTCGACGACGAAGAGGAGATCGCCGAGGGCGACATCATGACAGTCACGATCAGCATGACGCG
CAAGAACGTCAAGGAAGGCGACACGTGCGACTTGGTGTACGCGCCACACTTCCCATATCCAAAGGTCGAGCGCTGGTTCTGCATCGTGGGCGACACGAAG
AACAACCACTTGCACGCATTTGGAAAGATCACATCGCAGGAACGCACGGCCGAGTTGAAGCTGCAGTTACAGGCGCCTCCAAAGGCTGGCACGTACCAGT
TGGAGATCTTCGTCAAGTCGGACTCGTACATTGGCTTGGACTTGCGCGCGCTTGCTAAGGTATGTGCTGTTGTTTTGTTATTTTTTGTGCTGCGCTTACT
GTCTGCGGATGTGCGCATGTTGCTAACTGTTGTACTTCTTTGCCATTCTTGTAGTTTACGGTGACACCAGCCGCGCTGCTCCCAGTGTACCAGCCCCACC
CAGAAGATTTGGAATTAGATAACGAGCCGACGCTCTTTGAACAGGTCATGAACGCTGCGGATTCGAGTGATAGTGAAGACGAGGAAGAAGACGCGGAGAG
CAAGAAGGACCAATAG