Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.59
Orientation:
(+)
Number of Exons:
11
Description :
T-complex protein 1 subunit zeta
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-300
NN-scoreoddsWeighted Score
0.7643.0390.006
*** None ***
TypeScore
mitochondrial435
GO
*** None ***
*** None ***
*** None ***
Sequence
        4920 bases(100 bases per row)
ATGAGCTACCGCGGCATGAACCCGAACGCCGAGATCGTGAGCAAGTCGCAGGCGCTGCTCGTCAACGTCAGNNNNNNNNNNNNNCGCCGCCAAGGGCCTG
CAGGGTGTCCTGAAGTCCAACTTGGGTGAGCAAAGCATAGGATCTTGTTGGTTGATGCGGCAGCAACGCAAGGGGGAAGAGCTACGCTCGTTGTATTGGA
GGAGAGAAAACGCTAATGACGCTTAAATACATATGTGTAGGTCCTCGCGGTACGCTTAAGATGCTTGTCGGTGGCGCCGGCCAAATCAAGCTCACGAAGG
ACGGCAACGTGCTGCTGCACGAGATGCAGATCCAGCACCCGACGGCGGCGCTGATCGCGCGTGCCGCCACGGCCCAAGATGACATCACNNNNNNNNNNNN
NNNNNNNNNNNNNNNACGACATTTATTCATGCACTTCATTCGCCTCTCGGCTGCATGGCGTATCCATCTTCATTACTTTCATATAATGGGTTTTTATTTG
GACTGACGCTTGATGCTGATGTGCGATGATAATGCAGGGCGATGGTACCACCTCGACGGTCCTCTTCATTGGTGAATTGCTCAAGCAAGCCGAGCGTTTC
CTCGCCGACGGTTTGCACCCGCGTATCCTCGCGGAAGGCTTTGAGCTCGCCAAGGACGAGACTTTGCGCATCTTGGAGACGTTGAAGGTCGCGAACAAAG
ACATTTTGAAGGATCGCGAATTGCTCTGCTCCGTCGCGCGCACTTCGCTCCGCACCAAGCTGGACCAAAAGGCGTGTTACATGTTCTATCTTGCGTTTAT
TCGTCCATTTTGCCACAAGTATTCATCTGACATTCTATTTCGCTTGCTGTAGCTCGCGGACCAATTGACGGAAATTGTCACTGACGCTGTGCTGACGATC
GCGCAACCTGGTCGCCCAATCGACTTGCACATGATTGAAATCATGCACGTACGTACTCTAGTCTCCTTCCTTTTCTTCTCTCAGATCTGTATACGTTGGA
TTTATATGCTGAGCCTCACTGCTCTTCTTTTCTTTTTATGCATTTTCAGATGATGCACCAAAGTAGCAGTGATACCCGTTTGATCAAGGGTCTCGTGCTC
GACCACGGCTCGCGCCACCCAGACATGCCGACGTCGTTGGAGAACTGCTACATTATGACGTGCAACGTGTCGCTCGAGTACGAGAAGAGTGAAGTGAACT
CGGGTTTCTTCTACAACAGCGCCGAGCAGCGCGAAAAGATGGTTGAAGCCGAGCGCAAGTTCACGGATGACAAGGTCAAGCAGATCATTGAGCTCAAGCG
CGAGCTGTGCACGGACGAGAACAAGAAAAACTTTGTGATCGTGAACCAGAAGGGCATTGATCCGCTCTCGTTGGACATGCTCGCGAAGGAAGGCATCCTG
GCGCTGCGTCGTGCCAAGCGCCGCAACATGGAGCGTCTCACGTTGGCGTGCGGTGGTATGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGCCGGCAAGGTGTACGAGCAGACGCTTGGCGAAGAGCGTTACACGTTCGTGGAAGACGTCAAGCACCCGCAATCGTG
CTCGATCTTGATCAAGGGACCAAACGAGCACACGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAACGCCATCGAAGACCAAGGTGTCGTGCCTG
GCGCGGCCGCGTTCGAGCTGGCGGCTCACGAAGCGCTGAACCAATACCGTGGCTCGGTCAAGGGCCGCGCCAAGTTGGGCGTCCAGNNNNNNNNNNNNNN
NNNNNNNNNNNGGATGCGCTGCTGGTGATCCCAAAGGTGCTGGCCGAGAACTCGGGCTTGGACGTGCAAGACACGCTGATTGCCGTGCAGGAGGAGCACG
CGAACTCGGGCGAAGCCGTCGGCATTGACTTATTCACAGGCGAACCGATGCTGCCGGCGCAGGAAGGCATCTGGGACAACTACCGCGTCAAGCGCCAGTT
CATCCACTTGGCAACCACGCTTGCGTCGCAGTTGCTGCTCGTCGACGAAGTCATGCGCGCCGGCAAGAAGATGGGCGGCGGTGGCGGCATGCAGCCCGAG
GAATAAGCGAGGGACGTTTTAGTACGTAGTAATTTTTACTTTTCTAGCGATAAATAAGGGAGCGAAAGAGAGACAAAACAAAGCATTTTCACACACACGC
ACGTATGACAAAGCGAAATAATTCTAGAAGAGTGGCAATATGCATTGCACAGAAGGGTAAATGCGGCCGAAATCTCATTATATATTGAGCGCATGATATC
TTTAACGACGACGCAGGAACAACAAATAAAACACGACGATGTCTGTGATCGCGAGCAGGATAATGATAAACCACAAAAGCACCTGTATGCACATATGCAC
AAAGGTTATCAGGTTTTTGATCCTACAACGAATGAACAGTATGCACCATGCACATACATATATGCCGTTATTCAATTACGGTGTGTACGCAACATACCTT
GCGGCGATACGATCGGTCGGCGATCTTCTTGAGCAGCGAGCGCACTTCGCCCGTGATACTCGACGTTTCGTGGAGCATGCCCTTCATATCCTGCATCTGT
GACAGCTGCAACTCCAGATCCACGAGCACGTTTCGCGCCACTTCCTCGGATTCGTACATGACGTTCTTCGTGTGCTCGATCTTGTCTGACTGGCGCAGCA
GCGTTTGCACCGACTACTCCACACATGTCAAGCAACAACACACATTATGTGAGTTCCAAGTGTTCACACCAATACATAACAGCCATCACTGTGCAGAGTA
GTTCGCAACGATCGTTATGTATCATCCAGAAATCGCTGTACAAGACGAGCGGAGCTGTTAAATGAGGACGCGCCATTGCCATTCACACATACACACACAC
CTGGTCATTGGAGAACGTGCTGTAGTTGTTCATGTTCGGGTTCGCGTCAGGGCCAGGATATTTGCTGCCTGCGGACGTGGGGCTCCGGTTCTTCAGGTTG
CGTCCATTGACGTTTCCATTGACATTGGCATTGGCATTGCTGCCCGTGTCGCTCAGGTGGAGATCGCGGAAGCTGCCGTGCATCCTGGCGCTCGGATCTT
CTTCGCTCTCTTGTTGCGTCCTTTTTTCCGCTTGAGCCACTTGGCGCTGGTCGACCCTCCACGAAAAAAGAATGAATCAGGAATCCACACATAAGGGGTC
CACATTATTTAGATTCATATTAACTATAGTGCGCCACACTATTTTAGAGACTGCATGAATGGAAAGAGCGCACATAGTGCGGTGAGATGAGCTTCGGGAA
GACCAACTACCGCTCTGGTGGCACGCGCGGCGGCGCCGATCGTACGTGCTGAGCAGCGCTGCGTCACATTTAGATGATGCCGCTTATGCTATTACGTACC
TGTGTTAACGCTTTGTGTGTTATATCGCTATGTGTGCTTATTTTTTCTGTGCTGGAACAGAGTTCAAGTGGGAGGATGTGAAGAATGATAAATACCGTGA
AAACTATCTGGGGCATTCGCTGCAAGCGCCTGTGGGACGATGGCAAAAAGGTATGACTGCATGCATGCTATTGCATACTTAATTTGTATGCTGTTGAACT
ATAGCTAAGCGTGTTCTTATTGATTATGGCCTGCGGTAGGGAAGGATTTGACGTGGTATGCGAAGACGAGCAAAGAGCAGCGCGCGTTGGAGTTAAAGCA
GGAAATCCTGCTGGCCAAGCAACGCGACGAAGATCTGATGAATGAAGCACTGTACGTGATGTGCATGCCATTATTGCCCGCAATAATGATGGATGTTGCG
TGGGTACCCATTGTTGCTACTGCTGTGTTGTTGCATTGTAGGGGTCTTGCACCACGTCGCCGTCACGAGCCGACGGAGCAATTGGATGCTTCCGAGATGA
AAGAACTGCTGAAACGCGGTGAGTCGGAGCGCGATGGCATGGATACTGAGCGTGTAGAAGGTCTCGGAGCTGCTCCTGTGATCACTGGAGTCGAAACCGG
TCCGAAGAAGACGCTCGCGGAGCGATACAGGGAAACGCTGGAATCGGGGAAGCAGGATACAACGTTTGCGCTGCCTGGAACAATTGATGTGTCAAACGCA
AATGGGAACGCAGTGCACGAGAAAGGATCGAAAGAAGAGAGGAAAGCGAGAAAAGCAGCAAAGAAGCAGCAACGGAAGGAGGAGAAGAAAGCCAAGAAGG
AGCGCAAGAAGGAGCGGAAGGAGAAGAGGCACTCCAGCGCATCGCTCTCGCACCGTTCGAGTCGAAAGTACAGCAGTGACGACGATGAGCGAAAAAGTAC
TGCCGATCGGAGAAACGATCGCTCGAGATCGCGCTCTCGCGGCCGCAAGACTGAAGTCTCTCGGTCTGCTTCACGGTCGCCGTCGAGAGGAAAGTCGTCT
CGCCAGCGCTCGCGTTCGCGCTCGAAGGATCGAGGTAGAGACCGAGTTTTCGACGCGCGCGGATCTACGCGCCGCGCGCCGCGTTCGCGCTCTCGCTCTC
CACGCGCTGTTCATGCGTCGTCGTCGAGTCGACGCCGTGAGCGCTCACGCTCGTACTCTCCAGAGAGTCGATATGATCGGAGATACGAAAGACGCCGCTC
TCGATCCAGATCCAGGTCGGCACGCAGGGATTAGATGCAGAGAGCGGAGATGTCGCGGACGGCGAATGGCGTCGATACCAAGTATGTTCTTTTTTTCCTC
TCTCTTTTATACCCGTAAAGATACAATTGCCTTTCTTGCACCAAGAGCGTCTGCGTTCTTTGTATATTTTCTAGTCTTCTATGTGTATGTGCTGTACTGA
CTGATATTGTGCTGCTTTCCTGAAGCTTCGTCCTTGGCTTCGTCTTAGTCGGACTTGGAGGACGTATGCGCTTTCTTCTGCCGCCCACAGCGTTCCGAGT
TCCCGTCTTTGAGCTCGTAA