Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-fgenesh-gene-0.38
Orientation:
(-)
Number of Exons:
6
Description :
Eukaryotic translation initiation factor 4E
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-11
73-216
34-54
12-33
55-72
*** None ***
*** None ***
TypeScore
nuclear739
GO
*** None ***
*** None ***
*** None ***
Sequence
        2110 bases(100 bases per row)
ATGGCGTCCGGCGACGACGAGCGACACGAGCTGCACACGGGCTGGTCCATCTGGGAGCAGCGCGAACTGGGCAAAGGCATGGCGTACGGCGACAAGCTGT
TCAAGTTGTGCTCGTTTCGCACGGTGGAGGAGTTCTGGGCGTACTGGAACAACATCCCCAAGCCAAGGTACGCGACCACACGACATGCAAAAAGCCAAGA
AAGATACGATCGTATCCAATATGGTATGGTGGCTGGCAAATGGGAAATAAATGCGCTAATGTTGTCTATAAATGTGTATTGTATGCTGTCACACGAATAG
TCAAGTGCTCTTTGACGGGTTCACGAAGAAGAAGTTTGCCGATCGCACGGTAGAGTCGTTTGCGGTGTTTAAGGACGGCATTACACCGGAATGGGAAGAC
CCAGAGAACAAGCGAGGCGGCGAATGGTCCATCCGCAAAGGTAAATGACTGATGGTGATGATTTTTGCTTATGTATCGAATGCATACAGTTATGTCTAAG
GGCGTCTTTGCGTTATGGCATGCAACAGAAATCGGCTCTGAAGCGCTGGACGAGTTTTGGGACAAATTAGTGCTAGGTGCCATTGGCGAGACCATCGATC
CTGGCAACGAAATCACGGGCGTGCGCGTGATTCACAAAGTACGTCGTGAAGCAATCGTTTGAGTGGGGGTTATGGTGACGCCATGATACTGACTTGCATG
CTGTGTGTTTGCATTGACTCTTTTAGAACAAGCGTGACAAGAAGGAACCAGGCAACAACTACCGTTTCGAGATCTGGTTGCGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCTAGACCGCGCTCGCGCCGATGAGATCCGTGGCCTCGTGCTCAACTGTATGAACACGAACAACACGGGGCCGGCGTGGACGACGCG
CGAGTTTGTGTACAAGAACCACTAGGTGAAAATGAATGTGAAACAGCGCGATGGCAATGGGGAATCGAGACCAGAACGCTGAACCACGCAAGAACGAACG
ATGGGCGACCGCAGAGAAGCATCTGCCGACTGCGGTGCACACAAACAGAATCACCATGGGCACTTTTGTGACTCAGGTGACGAAAGAGCAACAACGCATA
AACAAAACAAAAAAGAATTGGAGAGAAGAGAAAACGAGACGAGATGGAGTGAGGGAACCGTAGCAAGCACTTGCTTTTGCCCGTGTGTTATACACTAGAG
ACCCAAACACCATACTAATAGAAAAACGGGAGGAAAACAAATGCCAAAGCGCGCATGCGCTACAACATAGGCAGCTCTTTCATTTTGTCCACGATATGTG
GACGAAGTGCTTCACATTTTTTTCTTTGCATGACCACCATGGAGAGTGTAAAGTTCGCATCAGAAACCGAACTTAGTGTAAGCGCTTGCACAAGTTGTGC
GTCTGTGGCGCCTGTGAATATTGGAGCAGCCATGTCGATGTGGAAGCAGCTCTTCTCGGAGGCGCCGCCGGGCGCCGTCGAGTACGTGGACGTCTACCCA
TCTATCTGTCCTATGGTTTCTATTATGGCTATCAGCGCCACTGACACCCTGCCTTGTCTTTCTCTCTCTGTGCATCGCCTGCGTACGTGTCTTCTCTAGG
AACCTGCTGTCGCCGAAACGCAAGTTCTGGTACGCCATGTTCGCGCTCACACCGGGCACGCTGCTCGCGCTGTACCTGCACAAGGTCAAGGTGGAGATGG
AGACCGAGGACGAGATGCTGCGGCTACAGCATATCCAGGACGAGCTGCGCGGCGAAGCCGATCGCGAGCAGAAGGACGTCGCGCTCATGGGCATGATCCA
GGAAATGCGCACGCGCATCGCGTCGCTCGAGCAGCAAGTGACCGAAGCCAAAGCGACTGCACACACACAGAGTAGCAATAAGGAATCAGCTGCAGCAGCG
CTCGGTAATGTCGAGACACAGGCACCGACGTCGACTGCTGACTGGGAGCAGCAGAAGGCGCTTTTTCTGGCGCCAGCACCACAATCGGGAGCAAAAAGCG
ATGCGCAGAGTGGGATCAACGAGCGCGTGAAGCAGCGCGAGCGCGAATTACTGCAGCACGATGTCAAGGAATTCAAAGCCGCGCGCGCCGGAGCCGCAAA
CGAGAAATAA