Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.49
Orientation:
(+)
Number of Exons:
6
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-105
162-224
269-305
129-142
243-245
106-128
143-161
225-242
246-268
*** None ***
PositionContextScore
157LGSRFLR|SY0.502
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4259 bases(100 bases per row)
ATGAAGACGTACGGGACGGCGGCGTTCGACGAAGACCACGGCCACGCCGTAGACGACGACGATCTGGAGGAGTGCAAGGACGAGTATGTGGACGACGCCC
AGCGACAAGCAGGCGAGCGCGAGAAGCTGAGGCAGCGAAGCCAGAAGAACGCAGCGGTCCCAAGTCCACACGCATGGTGGTCGTATGTGCTCTTCAGCTG
GTGCAAGCCGCTAGCGGAGCGGTGCGCGCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGGCTTTGAGAGAAGACGAAACAAGCCAGTTC
TGCGCAGATCAACTCAAGCGCGCGCTCACCAAGACGTTGTCGATCGTGCTTGCCGTGTGCTGCACGCAGTGGAGACTGCTCATGTGCAGCGGTGCGATCT
CGCTCGTGTCGGTCGCGTGCGAGTTACTGGGACCTATTGCGGTGTACATTATTGTGGACTCTGCAGCGACGCATCAGATGCGAGACATGTACTCGCGCGG
TGCGTTCTGGACGTTCGTGCTGCTTGGATCGCGCTTCTTGCGCTCGTACTCGCTCGCATGGGCCGATTACCTCTTGCGGTTTGTCGAAACTCGGACGGCT
GGCGCACTGCACGTACTGCTGCTGGAGAGCGTGCTGGACACCAACCGCTGTCGCTCACCGCGCGTTGAGATCTCTGAGGGCGCGCCGAATCTGTTCACGA
CTGACATTTCAGCCGTTGGGAATGCGTTTCGCACGATTCATCGCTTGTGGATGCTGCCGCTCGAGTTGTTTGGGTTTTTCATGATCTTCCGCTTTGTTGC
CGGACGCGTGATTACCAGCATCTTGGTAGTCTCGTTCATCATTTACGCCCTCATCCAGCTCGTGAACTGGTCGGAGTCGTCGCTGTATCGACAGTGGCTC
TCGATCTCCGACCAACNNNNNNNNNNNNNNNNNNNNNNNCTTTGGGATCCTACAGCGCATTTTCCAGAACATCCTCGCACTGAAGCTGAATACGTGGGAA
GAGTGGGCACTCATGCGAATCATGACGGCGCGCTCGACGGAGCAATTTGTGCTCAAACGCCATATCTTGCTGCGAACGATTCGATACACGCTGACGTGGA
TCGCGCCATCCCTGAACCTGATCNNNNNNNNNNACGGGCGTGCTGCTGCTGATCGTCCCCAACTACGCGTTTGCATCACCGGCGTTCACGTTCAGTGCTG
TCGCGATTTTCCATGCCATCAACGACGCGTTTGTGACAGCAGTCGGCGTGATTCAAGTGTTTCTCCAGTTTCGAGTCTCGCTCGAGCGGATCTATGCGGT
GTTGCAGCTGTCGCATGTTCCAGACAGCACGACTATGGAATCTGCTGGACGAACTCACTCCCTTGGCAACGTAGATGAAGACGCCGTCGCCGTGGTCTGC
GCTGTGTTTGCCAACCCGACGTCTCCTGAAGCCCTAGATTTGCTGGCAAATGTCAACATCCGCGTGAAACGAGGGGAATTTGTTGTGATCCATGGCAAGG
TCGGCTGCGGCAAGTCGGTGTTTTTATCAGCATTGCTGGGTTTTTTACCGAAGAAAGCTGGAGGAGTGTACCTCAATGGCTCCGTGGCGTACTGTTCGCA
GGTGCCGTGGATCCAGTCAATGACGATCCGTGACAACATCCTCTTTGGGAAAGAGTTTGATGAGGTGCGATACTGGAGCGTGCTAGAGGCATGCTGTCTG
ATCGAGGATCTGACAAGTCTACCAGCAGGCGATCGCACGATCATTGGCTCCCACGGGCTCGTTAGTATGTCTGGCGGCCAGCAAGCCNNNNNNNNNNNNN
NNNNNNNNNNNNGGCGTTGGCGCGCGCGTGTTACGCTGATGCGGACATTTACATACTGGATGCGCCCCTCGATAGCGTCGATAGTATTGTCCAGTGCGAG
ATTTTGCTCAAGTGTATGGGCCAATTGCTGCAGGACAAGACAATTATCCTGTCCACGCACAATCCCGAGTTGATCCTGTGCGAGTACGTCGATCGCGCTA
TTCTAATGGAGCAAATGGTGTTTCAGGAGCCTAAGCTCACGCAGAAGGAGGGGCGCCAGCCTCGTACGCTGTCTCGACGGGCTCAAGCAGAGAATCGACC
GGTGCCACGTGCGTTCATGTCGAAACGGAAAGTGCTTCTCGGTGACTCAGCGACTCNNNNNNNNNNNNNNNNNNNNNNNNNGTCTAGCGAGGAAACGCAA
AGACTCGCCTCCTGTTTCATTGGTCACAGACGCTCGGAGACTTCGACTGAACACGTCGGTGCTTTTGGATCCGTTGGTTCTCAAGCTTCAATCTGCACCA
CGATCTCGACAATCTTCGAGGCTTAATGTGGCAAACCACGCGTCGTGCGCTTACCGCCGGAAAGGATGGAGCGCGGTGCTGAAGGAGTATATCGCGTACA
CACAGAGCGTGTCAGTACTCTGCATTGTCATCTTTCTCCATCATATGACCCAAGTTCTTTCTACCATGAGCGTGTACTATTTCAGTCGATGGATCGGATC
TTGTGGAGACGCCGAAAGCTCGCCAGAAGCCATGGAGCATACGGACATGCTATTTAAGCGATACCTGTGGACAGTAGGTGGGAGCTGCGTCTCGTTTCTC
TGTGCGGCGTTTGCGACGTTCTCGTTCTCGCTGACTGCTGCTGGAAAACTTTTCGAGTGCATGACGTCGGCTTTACTGCACGCTCCGATGCGCTTTTTTT
CGACAAACTCGGTTGGCAAGATCCTCAACCGGTACGCTCGAGACCTGAAATCCGTCGATTCGTCGCTCCAAGGCGTCATTTTTACGCTGCTTCGCAGCTT
TTTTAGCACTTATTGCTCGTTGTTTGCGTCGCTGGCCTGGCTAAGCGGTCACATCCTGAAAGCCAACAGCCTCGCGCTGCAGAACGATGTCATGTCCATC
GTGGTGTGGTGGGTGGTGATGATTGTAAATGTGATAGTGACGACCGGCATCCTTGGCGCGTTCTGGCGCGACGGCATTGAGTCGAACAAGCCGTCGGGTG
AGATCTATCTGATGTTCCGCGAAACGCTGTCACCGATGTTCAACTATGTGACCGAGTCCATGAACGGCCGACGTGTGATCACTGCGTTTGGCTCGGAACA
ACGACTGCGCGTCGCACGCAACTATGGCGAGAAAGTGGACCAGGCCACGCGTATTCTAATGTCGATGTGGACGTTCGAGACGTGGGTCGCAATCCGCTGC
TTGTTCATGGAGAGCCTGTTGACGAGCTCGCTCTTGATCGCGCTCATCGCATTTGGTCACGATCCGTCGTATTCCAACCAGCCGGCCACCATCGGACTGC
TTCTCTTTCTGCTCTTAAATATCCGCGACGACATGAAAAACAGCTTTGCGAACTGGAACCTGCTTGAAAAAGACCTGGCGTGCGTTCAACGCATCTTGGA
GTACATTGACGTCGAGCCAGAGGGAGCTCTGAGCCAGAACCAGTTGCCACTGGACCCATTTTGGCCGCGCAAAGGATCAATCACTTTCCAGGACGTGTTC
TTCCAGTACGGTGGAGCTGAGGCACAGCCCCATCTACCCACGAGTGCTGGTGCCAATACAGTTTTAACTGGAGCCATGGCGCTGAAAAACGTGAGTTTCC
ACATAGAAGGAGGCCAGAAGATTGGAGTAGTGGGCCGAAGTGGTGCAGGCAAGTCGTCCTTGGCGATGGCGCTCATGCGCGTCAATGACCCAGCGTATGG
CGTGATCCAGATTGACGGCGTGGACGTGACGCGGCTCCACTTGAAGACGCTGCGCTCCAAAGTGTCGTACGTTCCCCCGAATCCAGTGTTCACGAATTCG
TCCTTGCGCGAGTACCTTGACCCGATGAACCACGTCGAGGATGCTGTGCTGTGGAAAATCCTGAAGAAGACTGGCGTCGAGGCGTCTATTTTGAAAGTGC
AAGCGTCGCTAGACGCGCCCATTATGGGGACGCTATCGAATTGGAGCACGGGCGAGCGTCAACTGCTGTGTCTCGCACGAGCGCTGGTGTTCCGGTCGCG
CATTGTGATCCTCGACGAAGCCACGACTGCTACCGACCAGGAAACGGACTGCAGCGTGCAAGATCTGGTGTACGAGATCCTCGACTCGAGCACGACGCTG
CTGTGCATCGCGCATCGGCTGGACACGGTCCTCGAGTTTGACAAGATCTTGGTCATGGCCGACGGCGGCGTCGAGGATTTCGGCACGGTGCAGGAACTCG
TGGCATCCGGAGACGGCGTATTTTACAACCTTCTGGAGAGTGCGCAGCTTGTGTATTAG