Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-fgenesh-gene-1.2
Orientation:
(+)
Number of Exons:
4
Description :
Mitochondrial ribosomal protein L51/S25/CI-B8 family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-63
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        894 bases(100 bases per row)
TCGCAGCAGCATCCGCAAGACGCAACCGAGTCCGCAGCAAAGATGGCGACGAAGGGAGTGTGGCAGCTGAAGGAGGTGACAATCCGTTACTGCCAGCACG
GCGGAAGCAGCCGCTACATTAGGTACGTTGATGGGGGATATGTGTGTGTGCTATTGTTGTTGCATGCGGTGCGCTCTACGTGCGCCATGACGGCTCTACG
TAGCTATCGATCGACTGTGCCAACCACGCGTTTGTATTGACAGCATGCATAATCAAATGCTTATAAACGATATTTTTTTGCTGTAGACAAATGCTCGGTG
ATGAGCGTTTCCTGAACTTCGTCAAGGAGAACCCTCAAGTGAAGTTTCAGACCGAATTGAAGGGCGCTCGCCACCCAGTCCTCATCGGCGATTACAGTGA
GTACCTAATGAAAATTTACCGCATTTGGCGCTACTGATCGCTAACATGTCCGCTGTATCTGTTATTTGTAGTCACCAACGACCGCAAGGTCTGCGATGTG
AAGAATCAGGACATTGACTTCGTCATGATGCAGGTACGCTATGCATTTCAGAAATGCTTTATTGCATGCATGAATGCGATGCTGACGATTTTATACGCGC
TGCTGTTTGTAGTTGGAGCGTATGAGAAACTCGAGCGGCCGAAAGATGACTGCGATGAAGAAGCCTGTGATCTCGAAGCGACCAACGATCCAAGGCATCT
GGCAGCCAGACCTTGAGTTCCCAGACTTCAAAATCGAGCACCGTAGTTAAGTGCTGAAGCAGGGAATGGCGATGCCGTTGTGCATACCACGTTGTTTTCA
TGATAAAAAAAAAAGAGAGATTCTGGATTCCTTTCAGACATTAGATCAACGGCTCTTGTTTGATATCGCTGAGACCATGTGTGTTCCTCCAACT