Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.52
Orientation:
(+)
Number of Exons:
2
Description :
Alkylated DNA repair protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-69
NN-scoreoddsWeighted Score
0.9376.5770.013
*** None ***
TypeScore
nuclear478
GO
*** None ***
*** None ***
*** None ***
Sequence
        825 bases(100 bases per row)
GATTCTCAGTGTCGTGCTCCATTCACGTGGCAAAGCGTCGATGCGCAAGCCATGCACCTCACCACACCAGGGCTCCCATCATTATCATCATCGGCATCAA
CTTTATCGTGTACTGCTCCCAATGCAAAGGTGTATTTCCTCACAAGCGACAAGACGAGCTGGGTCTACTACGCTCCGCAGTGGTATCGCAAAGTGTTCAA
GCAGCAACATGTGACGGAGTCTGACTGGAAAAACGCATATTCCCAGTGGCTGGATCGCGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCCGCAGCACGACGCGATCAAGATGTTTGGCAAGGATGTGCTCATGCCGCGGTTCCAGCAGGTGTATGGCGGCACCGACTACCGCTTTTCCGGCC
AGACGTTTGCTGCGCTGCCGATCCCAGACGACCTTGAGCCGTGCATTGATGCCATGCGGCAGCTCGTCGCGACCCCGATCGATACAACATTTTCGCTTGA
CTTTTACCGTGGGATCCTCGTGAACTGGTACGCGAACGGAGACCACTACATGGGCCCACACACGGACAACGAGAAGGCGCTGGTGCCACGCGCGCCGGTG
TGTTCGCTCTCACTCGGCACGACACGAAGGTTTGTGTTCACGCCCAAAGACTCAGGTCTAAAAGAACACGAGAGACTCGAGCTTATGCTCCATGATGGCG
ATCTGGTTGTCATGGGCGGCACGACGCAGGAGACCCACAAACACGCATTGCCGAAGATGAGTAACCAGAAGTTCGCTGTGGGCAAGCGCATTAATGTCAC
GATGCGGTGCTTCCGACAGCCTTAA