Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.57
Orientation:
(+)
Number of Exons:
6
Description :
Pc18g01730 protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-128
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1864 bases(100 bases per row)
ATGGCGCAAGAAGAAGCAGCAACGCAGCAAGAGCAGCGCGGCGGCGCGCGTTCGCACGCGTTTCTCCCGCGTCATATCATCGTGCTCGTGCACGGCAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGATTTCGACGCCATCGAGAGCGCGCTCGTCAAGAAATATGGCTTCGACGACATCTTGATCATCAAATCCAAGG
TCAACCACACGCAGACGTCGCTGGGCGTCGAGGTCNNNNNNNNNNGCTCGCCAGCGAGGTGTACCAGGAGGTGTTCCAGCACGAGTTGCACCCCGATATC
AACTCGTACAAGTTCTCGATCATTGCGCACTCGCTCGGCGGGCTCTACGCGCGCTTTGCGCTCGTGCAGCTCATGGAATCGCTCAGTCCGCTGGATATCC
AGTACGTCAGCTTCGTCACGATCTGCACCCCGCATCTCGGCTCTCGGCGGCCTCGAGGCGACTCGACGCTCAAAGTATAGTACTCTTTCTGTGCTTGTAG
TTCTTCAAGAAGGCTGTGTTGTTGATACAGTATTTTATGATGAAAATGATAGAATGTGTGGCGGATGGGCGTTCATACCGTGCTNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCGACGAATGCGCTGTATGGGCGAACGGGGGTGGACCTCCTCATTGATAGCAGCAGTGATGATGACAATGGATCGCCGGTGCCTCCGGT
TCTGGAGGTCATGACCAACCCAGGTAAGATGCATGTATAAACGAGGAGACTGTGTCTTTCACTGTTGAGGCTGTACTTATATGTGTGCCGTTGTGTAGAG
TTTGAGTATTTGAACGCATTGAAGCGATTTCGCTCTGGTACGCTGGTGGCCATGACGGATGGCGACATGCTCGTGCCGTACGCGTCTGCGTCGATCCGGA
ATTTCAATCCATACCCGAGTGCGATGTTAACCGACAAGTTCACGGAATGGCGATGGCATGTGCACCATTCTGGCTTCACGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTCCATTTTGGCGAAAATTGGGCAGCAGAGTGGACCTCGCGACCATAACGATCGAGAAATTGCATGTTGGCGTCG
ACGTGAGTACATGCGAACGGTTTCAAAGTGTCGAAGGCTACGACGCAGACAACAAACAGGAGGTCGAGTTCCCGTATGCGATGATCCAGAGGCTGCAGCA
GGCAATCCCGTGGCGTCGCATCGATGTGACCGTCGAGCCATGCGGCGTGAAAGGCAAGTTCCGCATCCATGACTGGCCGATCAACAAGATGCAGCCTCCT
GGCTGCCGCGCCGACGAATTCATCGACCTCTTGTGCGAGATGGTTGGACATGATCACGAGCTGGAGCCGCTCCCAGAAGCCAATGAAGACCAGCGCTCGT
CATCGAGTGCAACTCCGGTGGACAGCTCCGACGATGATACTGCGCCACGAAATCCGTTTGGTGGTCCCATGATCAATCGCTTTTTGGAGAAATTCCAGAA
AACGACACCGCCAGATAATCAAGTGTTGTCGCCTGCATCGGCTGAGAGCTCGAACGTCGATGACGAAAACCAGCAACAGCCTCGGAATTCGTTCTTTGGC
AATGGGATGAACCGCATGCGCGAGAAGTTCCAAAAGAAACAAGATGCAGGATCTCAATATGATGGCGCCCAGCCATCGCCATCGACCAGCAGCGGCGTGG
CGAGCAAGTCAATGGAGACGGAGAGTGAAAATACCGGCAGGAGTTCGTTCGGCGCCATGGGAATGCGGTTCATGGAGAAATTCACGAAAAAGGAGACGCC
TTCGCCAGCCCCGACGACAGCCGGCACCCCAACAGTGTCTTCTTCCACGACCACTTCGACCGAT