Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.64
Orientation:
(-)
Number of Exons:
3
Description :
Gene of unknown function
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7560.78825
InsideOutsideTMhelix
1-69
NN-scoreoddsWeighted Score
0.8184.0190.008
PositionContextScore
43STSRCRR|TA0.607
TypeScore
nuclear565
GO
*** None ***
*** None ***
*** None ***
Sequence
        556 bases(100 bases per row)
ATGGTGTCCGTCTCCAGTTTGTGCCTCGGTCTCATCGCCGCGTCCACGGCGTTCGTCGCTGCTGTCAACGCGCAGAGTTACAGCTCGCTTGATGAGTGGA
AGCAGTCGCCGTACTACACCGAAGCGTGCAAGAAGAACTTTGTCCCATCCGCAGGTCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGCAGCAGCAGCAGTGGCAGCAGCGTTGGCTCCGGCGAGTTCTCCATGGGGACTGTCAAGGCGAATGCGACGGTCGGCGTTAGTGAAGGTGATGGTG
AGATCGTCTCCGAAGAACAGAAGCGTTTCGAGCAAGCGTTGACGGATATCCAGGAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACGTCAACCGCAACAACGCGAACCCAGACCTCGAGATGTCGTCGGACGGCGCCGTGCCAATGACGAGA
TCGACGGAGGGAACGAGCAGCACGGACGGCGGCCCCATGACTGTCGCCACTGCTAA