Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-fgenesh-gene-1.5
Orientation:
(+)
Number of Exons:
5
Description :
Arabinogalactan endo-1,4-beta-galactosidase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7540.79724
InsideOutsideTMhelix
1-243
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3071 bases(100 bases per row)
ATGCCGGGCTACAAGGCATTCACGACGTTCCTCGCGTGCTTCGCTCTCGCTGCGCGTGCTGCCACCGCTACGGTCATCAAAGGCCACGATTTATCGTCCA
TGACGTACATGGAGACGCTGGAAGGCGTCACGTGGTACTCGACCGCGGGCAAACAAGAGAAACTGGAGACCATTCTCGGCGAGGGTGGCATGCAAAGCGT
CCGGCTTCGGTGAGTGCTATTTCGTTGTGGTTTCTATCACTGGTGCTTTTTCACCTTGACAAACTCTATCTGTCTTCGTTTGCACAGAATCTGGACGCTG
GACACGTATGGCCTCGACTACACGCTGAAGCTCGCCCAGCGGCTCTACACGGCAGGCTACAGCATCTACCTCGACATGCACTTTTCGGATACGTGGGCGG
ATGGAGAGCACCAACTCATTCCGGCAGCCTGGAACTCGACCGATCTCACGGAGCTCGCCAAGGACTTGCGCACGTATGTCAAGGAAACGCTCGAGGCTTT
CACGAACGGAGGCGTGCCCATCGAGATCCTCTCGCTGGGCAACGAAATCACGTCCGGCATGCTCTACCCGTTGGGCGAGACAAGGAACGGGAATTACACG
GGCCTGGCGACGCTCTGGGCTGCCTCGCGCGACGGCGTGAGAGACGCGGTGGCCACCGGCACGAAATGCCCCCAGATCATGATCCACTTGGACAACGGCT
GGAAACTNNNNNNNNNNNNNNTACACTTCTTCGAGGGGCTCTTTGGTACGGGTATCGTCAAGACGTCCGACGTGGATGTCTTGGGTTTCTCGTTCTATCC
GTTCTACGGCACGGGGGCCACCATTGAAGCGCTCACGNNNNNNNNNNACCTCGCTCACGACGCTCGCAAACATCTACAAGAAGCCGATCCATGTGGCCGA
GACCGACTACCCCAACGAGTGCCCGGGCGTCGAGCTCAGCACCAACTTCTCCGTCAGTACGGCGGGTCAGATTGAGTGGACGCAGGCGATCATCAAAGTG
CTCGAGGACCTTCCGCATGGTCTGGGCGCCGGCATCTACTACTGGGAACCAGCGTATGTGAAAGTGGCGAGTCTGGGCAGCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCACGTCGGCCCTGCTATTCTCGGTCGACTGGACGTATTGGCCCAACACCACGGCCACTGCGCTTGCATCCGTCGACCTCTTCAAGTGAT
ATTGAGGCTCTTTCAACCTCTTGGAATCGAGGAATTGCCATCACTCTATGCGTGTTTCATGATGTCGACGCGAAATTTCCACGAAGCCATAGAAAAAAGC
ATTTTGAGTATTTCGTCCGTTCGACAGGGTTCTCTCTGCTTAGAGCAATCATTTCTCTCTCATGCAGTTAACAAGGGCTGTTGCAAAATGAAAGCGTGTA
TAGAGATGACTCCACATAACTTATCACAATTTGAGTGAGACACCAAACTGTCTCCCTTATGTGCACGTGTAGCATTGTGTCCACATAACGTGGTCAGATT
GCGACAAATACGTGTACTGAATCGACTCATTTATAGAGACCACTATCAAAAGTCCAGCAGTTGTTTTATCCCGTTTTGCTTACTCTTCGATTGATTGTAA
GAGAGACGAGTGTCGTTATATTCGAAGTCGGGCACATTCCGAATGTCAAAAACCAGCAGAAAAAATAGAGGGACGTTCTAATCGAGCGCAATCGTTCAGT
AATCAGCCGATTGCCCTAGTGAGCCTAATTTGCACACTGCCTACGCACCATCATGGTGAGCTGCATGTAAAGGCCACCCGCCTTCAATCAGTCGACATCC
TGAGCCCCAGATGGGCGCGTCCTCGTCAAGACTATGTCACCGCATCTTCTTCTCACACCAGGCGTGCATCAAGTCATCCCAAAGACACTGTTGACGATGC
CGACTGCACCGGTTCCTGGTTCCCATGCGGTTTGCTTTGCTCACTTCGGGATTGACCCTCGCTTGAGCAAGTGCAGCATCTTCGACAAGGAACGATGGGA
CTCAAGGCGCTCTTACTCAGCGCGTGCGTCGCGCTCGGCATGCGCACGGCCGCGGCNNNNNNNNNNNNNCACCACAGGCCACGACCTGTCGTCTGCGGGC
TACATGGAGAAGGACAAAGGCGTGACGTGGTACACGGCAGCGGGCAAGGCCGCACNNNNNNNNNNNNNNNNNNNNNNNCCTGGGTGCCGGCGGCATGCAG
AGCGTTCGACTCCGGTACGTTTGCTTGATGCTCGTCTTGGATTTGCGTTTTTGCTTATTTAGGATCTGAACTTCCTTGGCTTGCGTTTGTTGTGTATGAA
CAGTTTGTGGACGGGAAGCGAGTACGGTCTCGACTACACGCTCGCGCTAGCCAAGCGGTTCTCCGCGGCCGGCTACAGCATCTACCTCGACATGCACTTC
TCGGACACGTGGGCTGACGCCGGCGCGCAGAAGATCCCGTCGTCCTGGAAGGCGTCAAATATCGAGGTGCTCGCTAGCAGCTTGCGCACGTACGTCAAGT
CGACGCTNNNNNNNNNNTCACTGCCGCTGGGATTAAGCTCGAGATCTTGGCGCTCGGGAATGAAATCACGGGCGGTATGCTCTACCCTCTCGGCCGCATC
CAAAACAACGACTTCAAGGGCTTTGCGAGACTCTGGGCTGCTGCTCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCGGTTGGCACGTCGC
GCCCCAAGGTCATGATCCACTTGGACAATGGCTGGAAGAAAGACACGGTCGCGTGGTTCTTCCAGAGCCTGTTCGCGACGGGCGTTGTCAAGAAGAGCGA
TGTGGATGTCTTCGGCTTTTCGTTCTACCCGTTCTACGACACGCGCGCCACGATCAGCGCGCTTTCGAGCTCGCTCTGGCACATGGCGAATGCGTACGGC
AAGCCCATCTACGTGTCCGAGACCAACTACCCGACGTCGTGCGCCAAGGTCAAGCTCAGCGCGAACTACCCTACGAGTGCCGCGGGCCAGATACAGTGGA
CCAAGGCGGTGATCAATGTGCTCCGTAGCCTTCCAAAGAACCTCGGCGCCGGCATTTACTACTGGGAGCCA