Transcript Name :
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_1-abinit-gene-0.157
Orientation:
(+)
Number of Exons:
2
Description :
E3 ubiquitin-protein ligase RING1
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, RING-type9.111PS50089
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        1021 bases(100 bases per row)
ACCGTCGTGGTACAGTTCAATGGTGGCCTGCAACTCGAGTTCACGCCGTCCCCGGAACGCCTCATGAGCCCGCTCATTGGAGTACCCATTGTGATGGGCG
GCATCCCGATGACGTTTGTCGGCGGCGCGCCGTCGGGTATGGAGAATGACTCGATGATGCGCGCGATGCACGAGCTGTTCATGCGCAGCCAGAGCGAGCA
GCGTGGTCCGCCACCCACGAGCAAGTCGTTCTTGGACACCCTGCCGTCGAAGATTTGGGACAGTGACGTGAACGGATCGGAAAAGTACACGGATTGCGCG
ATTTGCTTGAGCGAGTACGAGACGAAGGACCAGGTGATCTCGCTCCCATGCGGCCACGTGTTCCACAAGGACTGCGGCATGCACTGGCTGGTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNACATGCCGATACCAACTGCCCACGCAAGAAGATGCGAACAAGCCAGCTGCGGAGAACAGCAGCGATAGTGCAAGCAAC
AATGCTGAGCCGGAGCCCGAAAGACGACCGGAACAGAGCCAACCAGACGAAGAGCCAGAGATCGAAGCGATCCTGCGAACGCTGCTGGGCGTCCGCCGCG
AACGCTCCAACACCAANNNNNNNNNNTGACTCAACCAGAACGCGTGGTACGCCAGCGTGTGGACAACAGCGACTCGGTGCTTCCTGGCGCCGTTCCATCG
TCTACATCAGAGGACAACAGCAACAATGATGCGGAGCTCGACAACATGCTGGAAGAAGAAGCGAGTCGCTTCGTCGAAGAAGAGAAGTGCTCTATAGCTA
CGCAGCCACAAGCTGCTGATGACGGCGCGGNNNNNNNNNNNNNNNNNNNNTGACGACGTCGACATGGAAGAGCTCCTCCGTGACACGCGACCTGCGACCA
GTTCAGCCTAAACGACGATCTCACGATCACGAGGATAGGAATTAGTATTTAGATGCGGTTAGATTTGAGGTTTGGGTTGCAGGTTCGGCAACTCATCACG
ATTCTGACGCGCCGAGTGTAG