Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.62
Orientation:
(-)
Number of Exons:
1
Description :
Cysteine protease family C01A
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8220.86921
InsideOutsideTMhelix
1-230
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        702 bases(100 bases per row)
ATGGTGGCGTCTGTGTCTAGACTCGTGTGCCTCTCACTGCTCGCTGCGACTGTCACTGCCGAGCGCCACGCGTCGTACGACGAGTGGAAGCAGTCTAAGT
ACTACAAGGAAGCGTGCAACAAGAAGTTCCTTCCGCCTTCGAGCTTTTCGCAAAACACGGGCGAGTTCTCCATGGGCACAGCCACCGGAAGTGGCGATTC
GAGTGTCACGGCAGTGGAGAAGAAGCGCTTTGACCAGGCGCTGACTGACATCGAAGAGCTTCAGAAGCTGCACCCGTACGCCAAGTTCTCGGTCAACACG
CCGTTCGCGCTCATGACGCACGACGAGTTCCTGGCGTACGTCAACCGCAACAATGTGAACCCAGACCTCAGCCCACTGCACCACACGATCCACTCGACGA
GCAGCTCTTCGAATAGCTCTGCACCGATGACTGGAGCTAGTGCGACTACGACGACCTCTAGTGGAAGCAAGGACGGCGGCCTGAAGACTAGTGCTGCTGC
ATCTGGCGAGACTGTCGACTGGCAGCAGAAAGGTTGCGTCACGGCTGTCAGGGACCAGTCGAACTGTGGTGCANNNNNNNNNNCTGTCGACTGGCAGCAG
AAAGGCTGCGTCACGGCTGTCAAGGATCAGTCCCAGTGCGGCGCGTGCTGGGCGTTCTCGGCCACAGCAGCCATGGAGTCCGGTGTCTGCGTCGAAACTG
GC