Transcript Name :
Phyag_g2715
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PITG_06931
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA recognition motif domain9.9PS50102
RNA recognition motif domain10.787PS50102
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain, eukaryote0.31SM00361
RNA recognition motif domain0.3SM00360
RNA recognition motif domain0.009SM00360
RNA recognition motif domain, eukaryote0.59SM00361
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-228
NN-scoreoddsWeighted Score
0.7062.2760.005
*** None ***
TypeScore
mitochondrial391
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
*** None ***
*** None ***
Sequence
        1196 bases(100 bases per row)
ATGGGCTGCCGCTCGTTGGTTGGTCGAAAAGCGGCCAATCGGGAGACGCCCGTCGCTCCACTTAAAAGTACTATGGATCTTGCAGTATTACTATTGCTAT
ATTGGTATTACTGTTTAATGAGCCAACGGAGACGACCAGGAACTGTATCGACTTCAGGCCGGGCGGGGAGACAACCGCTAACGTTAGACTCGTTTGTGCA
AGCTGCAATTGTTGCaaatgcaccagcaactcaaTCACCGCCAAAGAAATCTCGTAGAAgacgcaagaagcagcaaaaacagcTATTAGCGCCAATCTCT
CTCGAACtcgaaccagcagcacctgcaccaccaccaatacAACCCCCAGCAAAGTCAAAGCGCCGCAGACGCAAGTCAAAGTTTAAACAGCCAGCAGAAG
ATTCTCCGAGTTGCAACTTTCGTGTTCGAGGATTGGTCAGTGCTGAAGAAttggaagaggaggacgaagcgGAGGAAGTTGAGAACGAAATTCGAGCCGA
TTTTTGCGCGTTCGGGGAGTTGAAAGACGTTGCAATTGTtagagaaggagaagaaggggAAGATAAGTTGGATGGTGACGTTATTGTCAAATTTCAAGAT
GCAGATAGTGCAGCTTCGGCTTTCGTTGCGTACGATGGCAAAGTGTTTGGTGGGAAGACAGTGATGTGTATTTGGGAGACGTCGACTGGCGAAGAGAAGA
gcagtgtggtggtggtgaatgGGATGTTAACGCCGGAAGAATTGGAGGAACCGGAGGAAGTGGCAGATGTGGAAGAGGAGATGATGCAGCTTTTTGGTAG
ACATGGAGAAGTGAAGGAGTTGCGGCTAAGTGAGGAGACTGGAGATGTCACGGTGATTTTCGATGATGAACAGGGTGCAGAGAAAGTCGTGCAGGCAATG
AACGGTTCGAAGTATGGCGGTCGTTTAGTGACAGTAAGTCTGGCTGTTCAAAACTGCGAAGCCTCAAGAAACGTCAAATGCGTCGATGACTCACCTGCAG
TGATAAAACGCATTGCAGCTCCTATTGTGCAGGTACGAAGCTTTTGTGTTTAACTGCGATAATATTGGTACGTGCTGAGCTAACAACGTTGCTGCCAACT
GCTTTTAACGCTCTCAAGCCCATGGAATCAGCTGGGCTGCAGGATCTCGTTGTCGCGTTTTTAAAGCGGCTCGATGCGCTGCAGGTGGGGTTGTGA