Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1655-fgenesh-gene-0.0
Orientation:
(+)
Number of Exons:
2
Description :
Copper-transporting ATPase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Synaptobrevin2.7PR00943
Synaptobrevin2.7PR00943
Cation-transporting P-type ATPase2.9PR00119
Synaptobrevin2.7PR00943
Cation-transporting P-type ATPase2.9PR00119
Cation-transporting P-type ATPase2.9PR00119
Cation-transporting P-type ATPase2.9PR00119
Synaptobrevin2.7PR00943
Cation-transporting P-type ATPase2.9PR00119
Cation-transporting P-type ATPase2.9PR00119
Synaptobrevin2.7PR00943
Profile scan predictionP-Valprediction_id
Heavy metal-associated domain, HMA19.741PS50846
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-525
589-600
651-793
854-1151
1207-1243
549-565
624-632
817-830
1175-1183
526-548
566-588
601-623
633-650
794-816
831-853
1152-1174
1184-1206
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
integral component of membraneGO:0016021IEA
metal ion transportGO:0030001IEA
cation transportGO:0006812IEA
*** None ***
*** None ***
Sequence
        3809 bases(100 bases per row)
ATGGCGCGAAAGAAGAGCAAGAGCGGCAGGAAGAAGAGCGGCGGCGGAGACGTCGACAAGCCGCCTGCGTCGACCCCGTCGTCGTCGCTGCCGGTCTCTC
CGTCCTCCGACTCGAACGGGAAAGACCACCAGAGTGGTGGGGTCGTGAGCTCTGTGTCCAAGTTCCCGGACATCGACGTCCACAAGCAGCACCAGGAGGA
GGAGGAGGAGGTCGCCGCGAAGGAGACGGTTGTGGTCGTCAACACACCGCATGACCAGGTGGACCTCGTCGTGGAGGTGGAGCCCGTGAACACATCTTCT
GACTGTTGCTCGAGTCAAATGAATGGTAGCAGCAGCATCGAAAACGGAGATTCGTGCTGTAGGAGATCGATTCTGGATGGCGTTGAGGTCATGGTTGTTG
AAGTCGAGAAGCCCAAGGCTGAGTCTTCTTGCTCGAGTAAAAAGAAGGTGGAGAATGGAGAGAGCTCGGGATCGTGCTGCTCAAGCGATAAAGAGGCGAC
TGTGGCTCTTCCTGAGCCTAAAGCGAAGAGCTCGTGCTGCAGCAGCTCTGCTCCTTCCTCCTCCTCTTCTGCTTCTTCTTCTCCAGCGGTAGTAACGACC
GAAGTGTCTGCTGAGAAGCCCGCGAAGAGTGGCGGGTGCTGCTCGTCAAAGTCCGCCAAAGACAAGGGAGGGGGAGACTCGTGCTGTGCTCCAAAGGCTC
CAGTTACCTCGAACGGCTCTGACTCTAGTACTGCTGCTGCTAACGGAAAGTCTGATTCGTGCTGCGCTCCAAAGTCGAAAGATGCCCCTGCTGCCTCGAA
GGGCTGTGACTCCAACGCTGGTGCAACTAACGGGAAGGGAGACTCTTGCTGCGCGGCAAAGGGAACTTCTCCTGTAGCGTCTAGCGGATGCTGTGGTGGT
GGTGCTGTTTCTGAAGCGAAGGCTGACTTGTGCTGCTCGTCCAAACCTGGCTCGAAGCTCGTGCGCAAGCCCTCCAACAGCCACCCCGACCGTGTGCGTG
AGCGTCTTTTCGACCGCGTCACTGAGTTCAAAAACGAGCGCGGCGTGAGCATGGCGCAGCAGCACAATGTGCCGCGCAAATCTGTCGCACTCAAGAGTAA
ACCCGCGGATCTACTGTCGCTGCGGCTCTCGATCGGCGGCATGACCTGCAGCGGCTGCTGCACGCGCATCGAGAAGTTCATGGAGCGGCGCCCCGGAGTC
CTCGACGTCAACGTTAGCTTGCTCACTAGTCGCGGCGTGTTCGAATACGACCCGAGCGTGGTGTCTGCCAAGGCGATCGAGGAGATGGTCGTGAGTCTCG
GCTTCACGGCGGGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACGTGTCCATTGTGCTGCATATTGGGCACGAGAATCCAGCCAAGGTTTGT
AACATTCTGTTGGAGATTCCCGGCGTCATGGCTGCTGAGGCGACCGAGGACGTGGCTCCGTCTACTTCATCTACGTTACCAAAGATGGTGGGCAACCAAC
GTGCCATTCTCGTGGAGTACGACCCCGAGCAGACTGGCGCGCGGAAGATCGTGCGCCACCTATCGAGCGTCCTTGGTTTCCAGGTCTACGCGTCGAGCCC
TCGCCCACTCGCTGTGCAGAATGAAGAAGCTGAAGCCAAAAAGTTCCGCAACTACTTGCTCTGGAGCTTCATCCTATCACTGCCGATCGTGATCATGGAG
TACATCCTGCCGCTGTTTATGTCTTCGAATCCTACCGACAGCGATATTGTGACTGGTCTCAGCTACAAGGACGCGATCGGCATCGTGTGCGCGACTCCGA
TCGTGTTCGTCATCGCGTATCCAATTCACGAGAGCGCGTTTTTGGCGCTGCGCTACGGCTCGCGCGTGACGATGGACGTGCTCATCTCGCTCAGCTCGTT
CACAGCGTACACGTTTTCGCTCGTTACCGTGGTGATGGGGATCTTTTTGCTGAACCCAGAGCGCTCCGAGACCTTTTTCGAGGTCACAGCTTTGCTCATT
ACGCTGATCCTCGTCGGGCGGTACATCGAGAAGATCGTCAAGGCGAAGGCGTCCAATAGTGTCGATGCGCTGCTTCGGATTCAAGCGAAAACGGCGATCT
TGCTGGAGAGCAGTGGAAGCGATGGCAAGAACGACAAGTCGCTGAAGGAGTCGTACATTGACGTCATCCTCGTCGAGCGTGAAGATCTGCTGCGGGTGCT
CCCTGGAACGCGTATCCCAACCGATGGCATCGTGGTGGAAGGCGCGAGCACGGTGGACGAGTCAATGGTCACGGGTGAGTCCCGCAAAGTGGCGAAAGAG
CCTGGTTCGACTGTCATCGGCGGTACAATCAATTCCCAGGGTGTGCTGATCATGCGCGTGACCCACACGATCACTGAGTCGATGCTCGCGCGGATCGTGA
ATCTCGTTGATGAAGCGCAGTCGTCCAAGTGCGTGAGCCAGAGCGTCGCTGATGTTGTTGCGTCTTACTTCACAACGTTCATCATCTCGATTTCGGTGGT
CATGTTCTATGTGTGGTATCACTTGGCGAAACACGGCCATGTGAACACCCATGGGTGGGCTCCATTTCCGTTTGCGCTACGCTTTGCGATCACGATCCTG
GTCATCAGTTGCCCGTGCGCGATCAGTTTGGCGGTGCCAACTGCGATCATGGTGTCGACCACGATCGGATCCCAGTTTGGCGTGCTGTTCAAGGGCGGCT
TTGCGATTGAAGCTCTGGAGAAAGTGGACGTCGTGATGTTTGACAAGACCGGCACGCTCACGAACGGCACTTTGTCTGTGGTCGATGCAGCTCTCCCTTC
CAGCACTAGCAACACCACCGACATTCGTCAATTGTGGAGCTACATTGCTGCGACGGAAAAGAACAGCGAACATGCGATTGGGAAAGCGCTGGTGTCGTAC
GCGCGTCAGATTAATGCGCCAGAGCTGTCTGCTGCCACATTTGTCTCTATCCCCGGGTGCGGCGTGAAGGCGCACGTTGGCGGCAGCGACGTCAGCATCG
GCTCGCTCAAATGGATGCAAGACGCGCTCAAGGTCGCGATTCCCGTGGACCTCCACATGGTGAACAGCAAATTCCAGCAACGAGGCTGCGTCGTTATCTG
CGTTGCGATCAACAATGAAGTAGCTTCCGTCGTCGCTCTTCGCGACACGCCGCGACCAGAAGCGCGACTCGTGATTGAGCAGCTCAAACGCCAAAAGATC
CAAACGTGGATCGTCACAGGCGACCAACGTGAGACCGCGCTCTCGATCGCCGAGATGCTCGGTATCCCCGAGTTCACGGTGATCGCGGACGCACTGCCTC
ATCAAAAGGTAGACAAAGTGCGTTTGCTGCAGAGCATCGGCAAGAACGTGGCGTTTGTGGGCGACGGTGTGAACGATGGCCCCGCGCTGGCGATGGCGAA
TGTCGGCATCGCGGTCGGTGCGGGAACGGACGTGGCGCTCGAGTCCGCGGACCTCGTGCTCGTGAAGGACGACTTGCGAGACCTGCTCAACGCTATCGAC
CTCTCGCGCTCGACAAACAGGATGATCAAGTGGAACTTCTCATGGGGGTTCATGTACAACGTACTCATGATGCCGCTGGCGTGCGGCGCGCTCTACCCGT
TCTTCGGCGTCTCGATCCCACCAGCATTAGCTGGACTCTCGGAGTTGCTGTCGTCCGTACCGGTGATCCTGTTCTCGCTGCTGCTCAACTTCTGGAGACC
TCCGTACAAAAGCAACGACAATGTCGATCTGGAGCAATCGTTCGTAGTGATCCAAGTCGATACAACCGATGCGACGGAGAAGACCCCGCTCCTGGTGAGA
AAGCCGTAA