Transcript Name :
Albla_Nc14021660
Orientation:
(+)
Number of Exons:
4
Description :
pyruvate dehydrogenase E1 component subunit alpha p
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-412
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00161
K00161
K00161
K00161
K00161
*** None ***
Sequence
        1460 bases(100 bases per row)
ATGGCTCCTCACATGGTCATTTCAGTATTTTTCACAGATTCGAACTTGCTATGCAGCGACTTTCGCAATTTGATTACTTTTGCAGGCTACTTTCTAAAGT
TCTTGCGTATTCGAACCTGTCAAGTTCGAGACGCGTAGACCACTCGAGATGTTGCGCCACCCGCTGTTTAGGTCCGCATGTAATTCTAACGCCAAGGAAC
TCCTACGACGTGCATTCAGCACCTCGGAAAAGCAACAATTTGAGTTTCTTCGCCCTTTCAAATTACACCGTAAATCTTGCTACATTCTATCCCGTAATGA
CTTGTTTTTAACGCATTTGGCAATGCTAGGGCTCGAAAAAGGACCTGAAAATCACGCTTACAGCTCCAAAGAGGAGCTTCTCGAGTATTATCGCTTGATG
TATACGATGCGTCGCATGGAAATCACATGCGATAATGAATATAAGGTATGCTTTGATGCTTTTCTTGCATGGAAAGCTCAGATTGACGTGTCAATAGGCT
CGAACCATCCGTGGTTTTTGCCATCTGTACGATGGTCAAGAAGCTGTCGCAACCGGAGTTGAGGCTGCTTTAGATCGCAAAGATGCTTGGATCACATCTT
ACCGTAATCATTGTACGATGCTTGCTCGTGGAGGCACAGTGAAATCAATTCTTGGGGAACTATTCGGTACTTCGGCGGGAGCTATAAAAGGAAAAGGTGG
ATCTATGCACTTTTACAGTAAGAAAGAAAATTTCTATGGGGGTCAAGGTATTGTCGGAGCTCAAGTTCCCGTCGGCGCGGGGCTCGGCTTTGCGTGCAAG
TACAATCATAATGGGGAAGGATTGATGCCATGTGCTATTACAATGTATGGTGATGGAGCGGCCAACCAAGGTCAGATTTGGGAAGCCGCTAACATGGCAT
CACTCTGGAAATTGCCGGTAATTTTCTGCATCGAAAATAATCAGTATGGTATGGGAACTTCAATTGCTCGCTCTTCGTCCAACAAAGACTACTATACAAT
GGGAAATCATATACCCGGTATTTGGTGCGACGGAATGGATGTTCTTGCCGTACGAGAATGCGCTCGGTTCATGAAACAATGGTGTGGCGAAGGGAACGGA
CCCATCTATGTAGAATTCTGCACGTATCGATACCATGGTCACTCCATGTCCGACCCCGGTGTAACTTATCGTAACCGAGATGAAATCTCCCAGATGCGAG
CTGCTCGTGATCCGATTGAAAGCGTGAAAAAGCGTCTTTTGGACTACAATATGGTCACTGCTGATGAGATCAAAGCAATTGAAAAAGATGTCCGGGCCGA
AGTTGTCAAAGCCGCGAAAGAAGCGAAGACTGCGGATCGCCCTCAAGAGGGAATAGCATTTGAAAGCGTCTACTCGGACGGAAAAGGTGGGCAACAGATT
CCTCCATTCATTCGATTTCCAGATTACGCCAAAAGCCTGTACAATGGCAAACCGCTTTAA