Transcript Name :
Albla_Nc14021720
Orientation:
(+)
Number of Exons:
2
Description :
myosinlike protein putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain8.8PR00193
Myosin head, motor domain8.8PR00193
Myosin head, motor domain8.8PR00193
Myosin head, motor domain8.8PR00193
Myosin head, motor domain8.8PR00193
Profile scan predictionP-Valprediction_id
Calponin homology domain11.931PS50021
IQ motif, EF-hand binding site7.529PS50096
HmmSmart predictionP-Valprediction_id
Calponin homology domain1.4SM00033
Myosin head, motor domain5.2SM00242
IQ motif, EF-hand binding site15SM00015
IQ motif, EF-hand binding site3SM00015
IQ motif, EF-hand binding site71SM00015
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1522
*** None ***
PositionContextScore
480RRKAIKR|ST0.629
1251PPSMQRR|DV0.534
1319QRQRFRR|MI0.772
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
Cluster Id
20
Sequence
        4637 bases(100 bases per row)
ATGGCGACGGCAAATCAATGCGAGAAAGCCTTAAAAGCCTGGATTTATGAGGTTACAAAGCAAGAACCACGACCAGAACCACTGATAGATGCATTGAGAA
ATGGACAACTCTTGTGCCACCTCGCCAATGCCTTAGACCCAACATGTAATCTCAAAATTAATCAATTGATGACAGTTTTCCATACGAGGGAGAATATTAG
CCGTTTCTTGGATTGGAGTCGTGCCCAGAGAGTCGGAGAGCAAAACTTATTCCATGCAGAGCATCTGCTTGATGACAATTATGCGGAACAGGTTTTTAAA
ACTTTAATCTTATTATATGAACAATTTGAAGGCGGAACGCAACTGACACTGGACAGTTACAATCTGCGGGATAATGTAACTAAAAAAAATGAAAAAAGCG
GAAAGAAGCAAAATCAAGGCACTCCTCCTCCAACTGATAAAGTGAGTGAGTCAGGAAGGGCTCACGGGAAAGCAGATTTAGAGCTTGGGGATCGTCTCGA
AAAAGACAAGACAGCTGATAAAAAACCTGAACGGTTGACCCCTTTCATGATGGGGAAAAACCTTATTGGTGTCAAGGCTAAACAGCTATCAATGTTTAAC
AAAGGCAAAGGCAAGAAGAATCATGATCAAACTCCCAAAAGCATGTCTCCTCAGAGCCCAGTCTCGGACATTATATCACCCTTAGAAGAGAATCAGTCAG
TATGGCTCGATTCGCCAAGTCGAATATCAGCAGTAGATGATGGAATTGGAAAATCTTCTATCCAAGGACTATCCAAACTTGCAAGCTTTGTCAAGCAGGT
TTCGTCAATCAGCTCGAATAATGATGCGCATGAGTTGGATTGTCGAGAAAATGATCAATTTGTGATGCAGGTTGATCCACGGCCTATGGGTCCTCGAAAG
TTTCAAGTAAACAAAAGTGGTACGCCAGTTACAGTATCATCATGCAAAGACACAGTGCCCACCCGGATTGAACATGGCGGAGATATAAAGTCTACAACAG
CATGTGATGCAAGCCCTTCGAATTATCATAAGGCTGAAGGAGGATGTGGCGCTCGCAAAAAGTTTGCCGATTTCTTGAAAGCCAACCCTCCGACAGACCA
AGAACGAAAAAGGGTATATGGAGATTCAGCACAATTATCACAGGCATCGACGATGGAGAAACGACTCCAGCCAATTTTAACTTATGAAGAAAATTTTATG
CTGGGTAGGCCAACTCAAATCGAAAATCCAACTATTAAGGTCGTGCGCACGAATAAGAAATTGATGACATTTCTGCAAAAACAACCATCGAAGGCACCTG
TTGTGAGAGGCTTCCCGGTGTCAGTGCCATGTTCAGTTGGAAGAGGGGAGGAAAATCGCTCTAGGATGCACAATTTCACCACTGTCCCTGTGAAAGAAGT
TTCTTTGTATCCATTTGGCCGTCGAAAAGCCATAAAGCGCTCAACAGGACAGAGCAATTTTGTCCGAAATCGGCAAACGTATCGCAATCTGCTTCAAAGA
CCGCACTTTGACCTTGAATCAAAACGCAGTCAGTTCATGATAGAACAACTACAATTCAAAGAAGCAAAAGTGAATGATAAATCAACCGCACCGAGTGATA
CAAACTTCATAGTTCCTGGTATGCAGTGCTATGTTCCAGACGATGAACATGTGTGGCTTCCTGCTCAAATTGTCAGATGCGATGAAAAATCAGGCGACGT
AGAGGTTGTCGTTTCCTTCGAGGACGGAATCGCTGAGACCCGTCTTGTAGACTTGCACAATCCGAAAATTATAAAAGCGATTGGCGGTCCTAAAGCCACC
AAAGTCGAATCCTTACCACTTGCTTGGACAGGCGACACGATCGAAGGTGTCGAAGATATGCAGTCTCTACGCTTTCTGAATGAGGCTTCCATTCTATACA
ATCTGAAGAAGCGATTCCTCGCATCACTTCCATATACTTTCACCAACACAATCGTGATTGCATTGAATCCATACAAATGGATGGATTCATTGTACGGAGA
TGAGCCATCAAAGCTTTACATGAAGTGCCATGGTCTGAAGAAGTTACAGCCACATGTTTACGCGACTTCGGCGGCAGCGTACCAACATTTGCTACAAACT
GGAAGCAATCAAAGCATTCTTGTAAGCGGGGAATCTGGGGCGGGTAAAACGGAGACTACAAAAATCATCATGCAACACCTGACAAGCATCGCAGGTGGTT
TAGATGACTCTACCGTTGACAAAGTAATAAGAGTCAATCCGCTTTTGGAATCATTCGGAAATGCCAAGACGTCTCGAAATGATAATAGCTCACGTTTTGG
TAAATTCACACAATTGCAATTCGATGCTAGCGGAATTCTTGTTGGCGCCAAGTGTGAAGCATATTTGTTGGAGAAGTCTCGAGTAGTTTCGTTGGTTCAA
GGAGAGCGCAACTACCACATATTCCATCAGCTTTTGGCAGGCGCATCCGCAGAAGAACGTCAACAGCTTCAGCTCGACACAAACAAGTCTTTTCGATATC
TGGGTGATTCATCTGAGCAAACAGTGATCGACGGCTTTGATGATGCGAAACTTTTCACCGCGACCTGCCGGTCGTTATCTTTGATTGGCTTGAACAATGA
CCAGCAATTGTAAGCTTCTTTATCTGTTTTTCGACAAGCTGGAACACATTGTCACCTCATTTTGTTTATATTTGTAGTACTTTATTCAAAATTCTTTCTG
GACTATTGCATCTTGGGGAGGTCCAATTTATGGAAACTGATGAAGAGGGATCAGCCAGTCAGAATGTGGAGCAACTTTGTGTGGTATCGGAGCTGCTTGG
ACTAGCTTCAACAAAAGTCGAAGGAGCTCTATGCACTCGGTCTGTCGTTGCAAGGAACGAAAGTGTTACCGTCTCACTTTCAGTAGCGGATGCTGAAGAG
AATCGAGACAGTTTGGCTAAAGCCATCTACTCTAAGATATTTGATTGGATGGTCAGAAGAATCAACCAAGCGATTGCAGTTGATGATGATGTCTGCAGTG
GTCAAATTGGTGTGCTCGACATCTTTGGGTTTGAAGAGTTTGCTCACAATGGTTTCGAGCAATTTTGCATCAATTACGCAAATGAGAAATTGCAGCAAAA
ATTTACTTTCGATGTATTCAAGACGGTCGAGGAAGAGTATACTCGAGAAGGCTTGCAGTGGGATCATATTGAATATCCGGACAATCGTGAAATCATTGAG
CTAATCGATGGAAAAATGGGGATTTTAGCCTTGATGAACGACCATTTGCGCCAACCAAGGGGTAGCGAGGAAGCTTTAGTGAACAAAATACGTGCAAGCG
CTGAATCTCAACTCGATTCTACTTGCATTCAATTCCCCAAAGTGAATCGCACTCAATTTACGATCAATCACTTTGCTGGCCCGGTCACCTACGAAACGGT
TGGGTTCATGGAGAAACATCGGGATACACTGCAAAATGATTTGATGGATTTGGTCTTGACAAGTGAGCTCGACCTATTGACAGAATTCTTTGGTAGTTCG
GAGGCACCTCGCGAAACAAAGATGTCAAAAAGTAGAAAATCAACCAGCAGTAAGAAAAGTCTCGGCACACAATTCAAATCATCGCTTTCGCAGCTGATGG
ATAACATCAAAACTACCAACACGCACTATGTTCGATGCATAAAACCGAATGCCAACAAAAGCTCTACTGAATTCGACAATCAGATGGTCATTGAGCAATT
ACGCTCTGCCGGTGTGATCGAGGCTATCCGAATCACTCGATCAGGATATCCTAGCCGGCTTACACCGCACGAGCTAGCTACTAAATATTACATCATGTTT
CCTCCGTCAATGCAGAGAAGGGATGTTTTTCAGACATGCTCAGCCTTTATGACCGCAATTGGTCGCCGCTCACCTCTCGAATATCAAATCGGAAAGAGTC
TTATCTATTTTAAAGGCGGTGTTTTAGAAGAGCTGGAAGCCATGAAGTCCGATTTTTACTATAACGAAGCCACCTGTATTCAAAAAGTTGTACTGGGTTA
CATTCAGCGCCAGCGTTTTCGTCGTATGATAGAGGCCATCACTGCATTACAAGCGTGGTCACGTATGGTCTTGGAACGGGCCGAGTATCAATATGCGCGA
AATGCAGTCATAACCATCCAACGAGTCTGGAAGCGATATTTGAATAAAGACCTCATAGATTCGGAAGCCCGTGGACATTCTTATGACAATATGCAAGAAA
ATGATTTCGTGCGTATGTCCGATGGTGAGTGGGTTGATGATGAAGATGCAGATGATCGCCTCACTGAAGGAAGTGAGTCGAGTTTTGAATGTAGCGAACC
AGTCGCATCTGCATACAAGAGTCTTAAAGCCACGCAACCGTCACATACGCAACTACCATCGAAGCAATTGAGCTACGAATCGACCAAGCGTGATTCAACA
TCTTATAATCCTTCAGTGCACCGAACATTGAACATGGATGAAATTTCAGAAAGTGCAAAACGTATTTTGGATGCAGTCGAACGTAAAGAAAATTTGGAGC
CCATCAGCTTGCAAGAAGAAAATACAATATTGCGCTGGGAAAATCGAAATTTGAAGTACGACCTCGAGATGATGCGAGAGCAGTGCAAAGACCTGCAGTC
TATAATTGTCGAGATCAACCGGAGCCGAAAGCGATAG