Transcript Name :
Pytir_DAOMBR486maker-pir_contig_973-snap-gene-0.6
Orientation:
(+)
Number of Exons:
5
Description :
Serine protease family S10
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase S10, serine carboxypeptidase5.2PR00724
Peptidase S10, serine carboxypeptidase5.2PR00724
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-32
53-295
33-52
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
serine-type carboxypeptidase activityGO:0004185IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        1043 bases(100 bases per row)
ATGACACTGATAGAACGAACGCCACTCCAGCCGCCAAATGCACGAATCGACGCCTCCAGCACAATAGCTGCCATCAAGGCGCTCCGCCTGCAGCGCGTCT
CCATACTTGCGTTGTCGACGCTGGTCTTCATTCTGATCGGTGCATGGGGGCTCTCAGTGCATCGTTGTAGTAGCGGCAGCGTGCATGATGGAAAGTCATT
GACGACGAACGATGCGACAGTACTCTCAGCACATGCTGCAACAAGCCAAGAGGTCTTTGTTTGTGGTGACACGAAGAAGCAGGACGCTGGGTATGTCACG
CTCCCTAACAAGAAGGACGGCCGCTGCTTCTACTGATTCTTCGAGTCGCGCAGAAGCCCGGTCAGCGACCCACTCGTAGTCTGGCTCCAGGGCGGACTGG
AGTACTCCAGTCTGGCAGGACTCTTCACAGAGAATGGGCCATGTCACGTGCTCCCGAACCTGTCGACCACACTCAATCCGTACTCATAGACAAATGAAGT
GAATGTGATCTGGCTCGACCAGCCAACCGACGCGGGCTACTCCTATGGACTAGACGAGGACCTCGACCATAGCGAAGACGACGTGCGAGAAAGCATCTTC
TGGTTCCTGCAGGGCTTTCTAGACAAGCACCCCGAGCTCATCGGCCGCCCGCTGTTCCTAGCGAGGGAGAGCTACGCCGACCACTACGTCCCTGCTGCAG
CACACTACATCTGGCAACAGCAGTAGCTGGAGAACAAGACTAGTACGACTGTGCATCCGCTCAACTTGCAGGGAATTGCGATCGGCAACGCGCTTGTGAA
CCTCGTTGCGCAAACCGCGCATGTGCTCAACAGGCCAACAACTCGTACAGCGTTACAGTCATGAACGCCTCTGAGATGGCGGCTGCCCAAGTCGCGTTGC
CAACGTGCGTCGAGCTGCTTAAGAGATGCCAGCTCAACGCCAGTGCTTGCACCGAAGCGCTTGCGTTCTGCGCAGAGAGGCGCTTGGCTCCTCTTAGAGC
GCCAAACCGGAACCGATACGACATCCGCATGGAGTACGAGTAA