Transcript Name :
Pytir_DAOMBR486snap-pir_contig_840-abinit-gene-0.16
Orientation:
(-)
Number of Exons:
8
Description :
APUM7 (Arabidopsis Pumilio 7); RNA binding / binding
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pumilio RNA-binding repeat58.266PS50303
Pumilio RNA-binding repeat10.74PS50302
Pumilio RNA-binding repeat9.9PS50302
Pumilio RNA-binding repeat8.104PS50302
Pumilio RNA-binding repeat10.437PS50302
Pumilio RNA-binding repeat6.517PS50302
Pumilio RNA-binding repeat8.664PS50302
HmmSmart predictionP-Valprediction_id
Pumilio RNA-binding repeat5.5SM00025
Pumilio RNA-binding repeat5.7SM00025
Pumilio RNA-binding repeat0.091SM00025
Pumilio RNA-binding repeat9.3SM00025
Pumilio RNA-binding repeat8.4SM00025
Pumilio RNA-binding repeat0.0014SM00025
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1002
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
*** None ***
*** None ***
Sequence
        3671 bases(100 bases per row)
ATGGAGCTGGCGTCCACGCACCACCACGCGATGGGAAAGCTCAATACTAGCACCAATGGCACGCTCGCGTGCTCGTCATCGTCGTCGTCCTCTGGGTCGA
GCGTCTCGGGCTCGGTGCACAAGGCGTCGTCCCCTCACGGCAGCGACGACGATCAACAGCGACTGCTGCACTCGGTGGACTCGGCGTCGTCGCTGAGCTC
GACGGTGTATGAAGAAGACGAGCAGACGCAGCAGACGCAGCATCAGCAGACCCATCGCCCCGGCTCAGCGCCGCCGAACCTCAACTTTGAGTCGTCGACG
TTCTTCCGCTTTGGCAGCTCGAGCAACTTCTTTTCGCACATGTACGTCTATGAGCTTATGGTTGTCAACTCTGTTGCTACGGTATTTGACGTGGTAGAAT
GCTCATCATGTTGTTGCACTGGCTCATTCTTGACTTCTATAGGAAATATGACGATGACATGGTTGGAGATGAGTTCCCGGAAGACTTGGTAGCGCCAACG
AGAGGCAACAATGACATTCTGCCTCCTCACGTGATCTCGCCGACGAACCAGGCGAGCCACGACGATCCGTTAACCTCGACAGTGACGACAGCGACGACGA
CGACCAGCGCGATTCCAGTGTCGCAGGCGTTCCCCGTGCCGCAGCATCGCTACAGCAGCACCAGCAGTCTTGTCGAAACGAAGTCAGCAACGATCAATCG
CCAGAGTCACCACGGCGGCGCGGCGCTGCCAAGCCACCGCAAGAACAGCATCGAGATGTTCCTCTCGCAGTCGCCGAGCCAGTCTCTCGGTGGCGATTTC
CTGAAGCTGAGCCTGGACGACCACAAGATGAGTCTGGAGCGCGGTGGTGCGAGCGGCGTTGTGGGCGGCAATGCGTTTGCGTCGGGCCATTTCACGCTGA
ACCCGGTGCCAAAGTCGCCAAAGAACTTTGTTCGCAGCAACAGCAGCAACCACATTCGCAACAACCACCTCCAGCAACAGCAAGAGCTACAGCCGCCGCC
GATGATGTCGCGGTCGAGCAGCGCAAGCAGCTACAACAACTACCAGCTGAGTCCGCGCATGGGCTCGGAGGACTCGTGGCACGGAAGCCAGGACGGCGGA
CAGCAGTCGTCTGCTGCTGCGTACTACCAGGAGCAGGAGTACTACGGTGGCAGTGGAGGTGGTAAGGGACCGTCTTCGCAGTATGGGAATGTGAGTAGCA
GAGAGCAGCAGCAATACCACCAGCAGCAACAGCAGCAACGTCAGCAACAAGATCACGGGATGTACCGCAACAACCACAGTGCGTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGCAACGGCGGCTATGGCAATGGTCGTAACCAGATGAACTCGGGAGGAGGACAGTGGAACCCAAACATCGTGCCATCCGGAGGCG
CTACGTACAACTCGAACGGCATGTACATGAACGCCCCGCACGCGAACCAGATGCAGCAGCAGATGCACTACCAGCAGCAGCAAGGCGCTCCGTTGGGAAT
GCGTGGCAACCCTGGAAGCCGCGGCGGTCGACAGAACATGGGCAACAACCACGGCTACTCGCGCATGACCCCACCGCTTCCGGAAGCCTCTCCACCGCAC
TCGCCTCGCAAGAGCATGCACCACCAGCTCGGCATGGGGCTCGGCTCATCCATGGGGATGACCAAGCAGTGCAAGTTCTTCCTCCAGGGTCACTGCCGCA
TGGGCAGCAAGTGCAAATTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTGCAGAACCAGCACCACATGCAGTTGCCGCAGCACA
TGGGCCAGCACGGCAATAGCTCCTCTGGACTTGGCGGAAGTGGCGCTAGTATGTACCAGCAAGTGCAGATGTCGTCTCCGCACCACCACCAGCACCAAGG
CAGTAGCGACGAGTATTCGCACTCGTTTGCGCGCCAGCAACAGTCTCGAAGCGGATACAGACAAGCCGACATCGGTAGCTTGAATGGTGGAGGCATGAGT
AGCGGTGGCAGCAGCTTGAACGGAAGCGTTAGCGGTCTCGGTGTCGGCGGCTCTCAGAGTGGCGGTGGGCTCGGTGGTATCAGTGCGCCGGGTTTGATCT
CCGCTGTGGACTCGTCGGGTCTGAGCGCTGCGCTGGGCGTGGAAGACATCCAGGGCCGCGTGTTTGCGATGTCGAAGGACCAGAACGGCTGTCGTCNNNN
NNNNNNNNNNNNNNNNNNNNNNTGCTGCAGGAGCAGCTGGACTATGAAGACCGTCAGGATCTGTGCGAAGTGATCTATCAGGAATCGCTGGACCACTTGG
CGGAGATGATGGTCGATCCGTTCGGCAACTATCTGTTCCAGAAGCTGCTGGAACGTGTGAGCGAGAAGAAGCGACTCGCGATCATCCGCCGCGTGAGCAC
GAACNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCGGCGCTGAACCTCCACGGCACGCGATCTGTGCAGAAAGTAGTAGAGGTGTGCGCGACATCGGCGGA
AATGATCGAGGACGACAGCAGCTACTGTGACGATGACGACGACGATCTGACTGACAGCGGTGAAAGACGACGACTGAACGGCAGTGGACGCCGAACGGTG
AACCTTCCGGACATTATCGTCGAAGCGCTGAAGGACGACGCGGTGCGCTTGTGCATCGACTCGAACGGCAACCACGTGATCCAGCGCGCGCTCCAGTATA
TGAAGCCCGAGTACAACCAGTTTGTGTTTGACGCGGTGTGCAAGGAGTGCACGACTGTGGGCACGCACCGTCACGGTTGCTGCGTGCTGCAGCGCTGCCT
GGATGCGGCGAACAAGCAGCAAAAAGCCGAGGTGATCGCACAGGTGGAGAAGCAGGCGATGAAGCTGATGCAGGATCCGTACGGTAACTACGTTGTCCAG
TACGTTCTGGACTCATGCACGGCGGAAGAAGCGTACGGCGTGATTGTGAAGCCGCTCGGCAATATCTTCGAGCTCTCGATCCAGAAGTTCAGCTCGAACG
TGATTGAGAAGTGTCTCGAGAAGGCCCCTGAGCGCGTGCGCCAGAACTACATCAAGGAAATTATCAACTGCCCGAAGATGAACAAGATGCTGCAGGACCA
GTTTGCAAACTACGTGGTGCAGCGCGCACTATGCGTGTGCTCGGAAGAGCAGTGCCTGCAACTGGTCAAGTCGATCCGTCCGCACTTGGCGTGCATGAAG
AACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGCGGCCGCCGCATCACGGCGCGCATTCTCAAGCGCTTCCCGAACATGGACATTAGCTTGGACAT
GGGGCTCTCGCCGACGAGCGACAGCGGCATGTACGACAATAATGGCAACCACCTGCCGCAGCTGAGTCGTCTGCCTCCGTCTGTGATGGGCTACGGCCAC
CAGCAGCACATGGGCCACCACCACCACCACCACCACCAACAGCAGCAGCAGCACATGGGTCACCACAACACGGTCGGTGGCGGCGGATNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCGCACGCGAACCACGGCATGCCAAGCGGTGGCGGGTACACGTCCCACCCGCAGCAGCACCACCAGTACGCTCCGTCGC
AGCACATGAACGACGGCGTTGTGGTGGGCAGCGGCCTCGGGATGAACGCGGCGGGCACTAGTCGCGCGTAA