Transcript Name :
Pytir_DAOMBR486maker-pir_contig_825-fgenesh-gene-0.3
Orientation:
(-)
Number of Exons:
1
Description :
DEAD/DEAH box RNA helicase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif10.273PS51195
Helicase, superfamily 1/2, ATP-binding domain33.923PS51192
Helicase, C-terminal18.635PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain2.5SM00487
Helicase, C-terminal3.4SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
RNA helicase, DEAD-box type, Q motifIPR014014
*** None ***
InsideOutsideTMhelix
1-883
NN-scoreoddsWeighted Score
0.5691.7060.003
PositionContextScore
369FVHRVGR|AA0.54
745WDVRKKK|FV0.558
774VNVRKKK|EV0.683
847EEKRKAR|SR0.601
861SGARTKR|GK0.71
TypeScore
nuclear522
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
*** None ***
Sequence
        2652 bases(100 bases per row)
ATGGCAGGCGACGACTTGCTCAAGAAGGCCAAGAAGAATGCGCCGAGCAGCGCGGCTGCCGGTGGCACCACACACGGCAAGAGTAACGGCAAAGGCGCCG
GTGTTGGCGGCTTCCAGCACCTCGGGCTGAGTCCGCTCGTGTTCCGCGGTGTCATGGCCATGGGCTACAAAGTGCCGACGCCGATCCAGCGTAAGTCGCT
GCCGATCGTGCTCTCGGGCAAGGACGTGGTGGCGATGGCGCGTACAGGTTCTGGAAAGACCGCGGCGTTCCTAATCCCGATGCTCGAGAAGCTCAAGGAG
CACTCGAAGAAGATCGGCGTGCGCGCGCTGATCCTGTCGCCGACGCGTGAGCTCGCGGTGCAGACCATGCGCTTCACGAAGATGCTCGCGAAGTTCATGA
ACCTCAAGATCTCGCTCATTGTCGGTGGTGAAGGCATGGAGCAGCAGTTCGAATCGATTGCGTCGAACCCAGACATTATCGTGGCGACCCCCGGTCGTCT
GATGCACCACCTGCAGGAAATCCCGGACTTCAACCTTAAGGTGGTCGAGTACGTGGTCTTCGATGAAGCCGATCGCATTTTCGAGATGGGGTTCGCGGAG
CAGCTGCAGGAGATTCTCAAGAACATGCCAACAAGTCGTCAGACGTTGCTGTTCTCGGCGACGCTGCCCAAGGCGCTCGTGCAGTTCGCGCGCGCCGGTC
TCAGCGAGCCAGAGCTGATTCGTTTGGATGTCGAAAACAAGATCTCGGAGAACCTCAAGATGACGTTCTTCACCGTGCGCTCGAATGACAAGGCGGCACT
CTTTCTGTACATGGTCCGCGAGTTCATCCCGAAGGACGATCAGACGATCGTGTTCGCGGCGACACGACACCATGTGGAACTGCTGCACGAGCTACTGCGT
GCGAACCATATCGAGTCGTCATGCGTGTACGGTGACATGGACCAGGCGTCGCGCAAAATCAACATCGGCAAGTTCCGCGCCAAGAAGACGAACCTGCTGA
TCGTGACGGACGTGGCGGCGCGTGGTATCGATATCCCGCTGCTCAACAACGTGCTCAACTACTCGTTCCCGTCAACCGCCAAGCTGTTCGTGCATCGTGT
CGGTCGTGCGGCGCGTGCAGGTCGCAGTGGTACGGCGTTCAACTTTGTGGACCCGGACGAGCTGCCGTTCATGGTCGACCTCCACCTGTACATTGGTCGC
CGCTTGGAGGACTCGTCGCCCGTGGGCGTGCCATCGTACTCGCTTGACACGATGCAGGTCACAGACATTCACTACGGCGCGTTCCCGAACGAGCTGATCG
ACCAGGAGACGGAGCATATGGCGGATGTGATGAAGAACCACCCGCAGGTGTCGCCACTCGTCAAGGTGTGCGACAACGCGTACAAGGCGTACACGCGCAC
GCGTGCGGACCCGTCCAAGCTGTCGATCAAGCGCGCCAAGGACGTACTGGCGAAGAAGATCCACCCGCTGTTCATGGAGGCGTACATGAAGGAGGACTCG
AAGGCCGAGAAGGTGGAGTACATTGAGTCACTGCAGACCTTCCGGCCACCGCAGACGATCTTTGAGATCGCCTCGGGCACGCACTCGGCCAAGAAGAACT
CAGCTGCGGTCATCATGATGCAGGGCAAGCGCAAGCTTCACGGCAAGATCATCAAGAAGGAGGCGACCAAGGGCGAGAAGGACCACACGGGCGTGCTCGA
CAAGGTCTACGAAGAGGACTCGAGCGAGGAGCTGACAGTGAGTGACAAGGAGGCACTTGCGCGACGCATCGCGCAGAAGGCGGAGGCGGACGCCGCGGCG
GCGCGCGAGATGGAGCAGCTGCAGCAGTCGCAGAAGAAGACTTTCTTCCTGTCCAAGTTCGACCGCAAGCAGATCAAGAAGCGCGTGGCGGCGGGCGAGA
AGGAGGCGGACGTGATGAAGGAGATCGCGGCGGCCAAGCAAACCGAGGGTGGCAGCGGTGTTAACACTGGCGAAGACGGTGATGACGACAACATTGTCGA
GGAAGAGGACGACGGCGGCAAGAAGAGCTTCATCGACCGCGAGAACTACATCGGGTACATCAAGGAGGGCGAGCACGCGACCGAAGAGTTCCTCGCGCGC
GGCGCCGAGGGCGGCAAGGTGAACTCGTTCCAGGAGGCGCGTCTGGAAGAGGCAATCCTGGACGTGAACCCGGACGAGGCGATCGAACTGAACAAGAAGC
GCCGCATCCTGCACTGGGACGTGCGTAAGAAGAAGTTTGTCAAGACGACGGCGGGCGAGCTGACGGCGCAGGGCACGCTCAAGCGCCGCAACGAGAGCGG
CGTGAACGTGCGCAAGAAGAAGGAGGTCGGCGCGATCTACAAGAAGTGGCAGCAGCGCCAGAACAAGCGCGTGTTCACGGGCGGCGAAGAAGGCGACGAG
GACGCGGGCGACGGCAAGCGTCTGGACTACCGCAACGGCAAGAAGCCGCAGCTGGCCAAGAAGACGAACGTGAACAAGCACGCCAAGGACGAGCTGCTGA
GCGAGACCAGTATCCGCAAGGAGGAGAAGCGGAAGGCGCGCTCGCGCGGCGTCAAGGTCACGAGCGGCGCGCGCACCAAGCGCGGCAAGGGCAATATCAA
GGGCAAGTCCCACGGCGCGCCGACGAGAAGCAAGGCGATCATGCGGAGATAG