Transcript Name :
Pytir_DAOMBR486maker-pir_contig_825-snap-gene-0.6
Orientation:
(+)
Number of Exons:
1
Description :
Metalloprotease family M20D
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-694
*** None ***
PositionContextScore
299LRKRKKR|KV0.857
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2085 bases(100 bases per row)
ATGAGCGAGGACAGCGCCAAGAAGATGAAGCAGGGCGCCGGCAAGCGCCTGAACGACAAGCAGCGCGTGGAGATCATCCAGATCTCCGAGAACTCCAAGA
TCTCCAAGCGCCAGCTGGCCGAGAAGTACGGCGTGAGCGAGGCCGCGATCCGCAAGCTACTGCTCAAGAAGGACGAGTTCCTCAAGCGCTACTACGACAC
GCCCGAAGAGATCCGCGACCAGCGGCTGCGCGGCAAGAACCTCGGGCTCGGCCACGAATCTGCCGACGTGGTGCAGACGGCTGCTAACGGCATCGACTAC
GCCAGAGGTGCGGCGACTGTCAGCACCGGCGTACCGACTACATCTGCATACACCAAGAGCCTGTACCCTCCAGACGACCCGTGGAAGCACGGACTCCCTG
CGCTTGCGGGTAAGCTGGCGCCATTTTTGAAGAATTTTGCGCAGGGCAAACCTCCACGCGATGTAAACGCCGTCGCTGTTGCGATTGCTGCCGCTGGAGA
AGCGGGTGATCCTGTCACTGCGGACGAACCGAGCGCCTCGAATGCGGCGATCGATTGGATTGGATTCTCGCGCATGCTTCGCGACATTCGCCGCGCATTC
CATCGATACCCAGAGCTCGGCTTCCAAGAAGTGCGCACGCAGTCGTTCATTAGACGTTTCTGCGAGACAACGCTCCGTATTCCAGGTAAGAACATCCAAG
CGATTGCGACGACGGGTTTAATTATCGATGTGTGTTTTGAAAACGCCACGATCACGTCGAGCGACAAAAGAAAGCTCCCAGTTATTGCGTTCCGCGCGGA
CATGGACGCGCTCCCGATTGAGGAAATGAATGACCACTTGCCATACTGCTCAACGCAAAAGAAGCAGCGCAAGGAACTGCGCAAGCGCAAGAAGCGAAAA
GTGAGCAGCAGCATCGCGACGCCAGTCAAGGCAGACGACCAAGCGAGCGACGAAGCCGTCCCTGAAGGATTCGTGACGCCTGTGCAGTTGACTCCACGCG
CCCAAGTCGGTGAAGAAGCTGCACACGAGAGTGGAGATGTCGACATGGAGTCGCCGACGGCGCCAGCAGCTGCGCAAGACGGCGAGGAGCTTGACCAAGA
CGCGAATGGAGGCTTCCCTGTCGCTGCACACATGTGCGGCCATGACGGCCACATGGTCATGGTTCTGGGGCTGTGCGCGCTGGTCGTCCGCAATGCGCAC
TTACTCCCACAGGACACGTTTGTGCGATTCATTTTCCAGCCAGCAGAAGAGGGACCAGGTGGTGCAAAGAAGATGATTGAAGAAGGCGCGCTCGACACCG
TTGACGAAGTGTATGGTGTGCATAACTACCCATTCCCTCTCTACAGCGTGCACCTGCGTCCCGGCCCAGTGATGGCGCACGAAGTCGAGTTCTCGGTCGA
CATCAACGGCGTCGGCGGTCACGGCTCGGCTCCGCAGCAGTGCGTGGACCCGATCCTGGCAGGCGCGATGGTCGTGCAAGCGCTTCAGTCTGTTGTGAGT
CGCTCGCTCTCGCCGACCGACACGGCCGTGCTCTCGGTGACACAGTTCCAGGGCGGCGAGACCAACAATGTGATCCCGTCGCACGTGTTTCTCGCAGGCA
CGATCCGCGACTTTGACCTGGAGGTGGCCGAGAAGATCAAGGCGCGCATGGAGGCCATTGTACACTCGACGTGCGCTGCGGTCGGCGCGACGGCGCAAGT
GCACTTCAAGGACGGCTACGCGCCTGTGATCAACCCGTACGAGGAGACGCGCAACGTGCAGCAGGTGGCAATGGACATTGGCTTGTACGTGAGCGAGCAG
GGGCTGCCACTGATGGCGGCGGAGGATTTCTCGTACTACCTGCAAGAACGCAAGGGCTGTTTCTTCTTCTTGGGCACGAAAGAAGACGCGGACGACGACA
AACTTCGCGCGCTGCACTCGGCCCAGTACGACTTCAACGATAAGGCCATCCCATTGGGCATCCGCCTGTTCCTCGGCATCCTGCAGTCGCGCTTCCAGTG
CGAGCTCTACTCGGCCGAGGAGATGCAGGCGTTCCAAGTCGCGATGGAGCGCATTGCGCTCCCGAGCACCGTGACGATAGTGTAA