Transcript Name :
Pytir_DAOMBR486maker-pir_contig_514-snap-gene-0.7
Orientation:
(+)
Number of Exons:
3
Description :
Myosin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain2.9PR00193
Myosin head, motor domain2.9PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site10.091PS50096
IQ motif, EF-hand binding site7.547PS50096
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain2SM00242
IQ motif, EF-hand binding site0.75SM00015
IQ motif, EF-hand binding site230SM00015
IQ motif, EF-hand binding site0.014SM00015
IQ motif, EF-hand binding site5.9SM00015
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1022
*** None ***
PositionContextScore
272ESPRFAR|DA0.515
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        3225 bases(100 bases per row)
ATGAAGGCCGAGGATTTCCCATTTGTGGACGCGAAAGGACAATCGGTGAGTGAAGGTATGAAGGACGCGCAGCGGTTCAAGCAGACCGTGTCGTGTCTCG
AGACCATGGGCGTGTCGTTGGACGACCAGCTGAGCATTTTCAAGGTCGTCGCGGCGATCCTGCACCTGTCGCGTTTGCAATTCGCGTCCACGCAGGGTAA
CGAAGACGCGTCCGAGCTCGTGAACGACCCGGCGAACTTGCGCGCGAAGGAGGTCGTATCGAAGCTGCTTGACTTCTCGGAGGAGGAGCTCGAGAAGGCG
CTCGTGACGCGCCAGATGTCGCTCTCTGCGGTCGAGACGTACCAAGTGCCGCTGAACGTGTCACAGGCGCAGGGTGCGCGCACGGCGCTGGGCGTCGCGC
TCTACTCGCACCTGTTTGGCTGGTTGACCCACCGCGTAAACATGTCGACGAGCGCGCCCGCTGCGGACGTCGCGAACAAGATCTGCATCTTGGATATCTT
TGGGTTCGAGATCTTTGAGAAGAACTCGTTCGAGCAGCTCTGCATCAACTACGCGAACGAGAAGCTGCAGCAGAAGTTCACGCAGGACGTGTTCAAGTCG
ATCCAGGTCGAGTACGAGGAAGAGGGAATCCCATGGACGCGCATTGAATTTGCGGATAATGCGAACGTACTGGCGTTGATTGAAGGTCGCTTTGGTGTGC
TCTCGTTGCTGAACGAAGAGTGCATGCGACCAAAGGGCAGCGACGACGCGTTTGCGAACAAGCTCAAGGCGCACTACAACGACAATGACCGCTTCGAGAG
CCCTCGCTTTGCGCGCGACGCGTTCGTGATCAAGCACTACGCCGGTCCGGTGCAGTACGACACGAAGGGTTTCTTGCTCAAGAACACGGACGCGCTGCAG
AACGACCTGATCGTGCTCATCCGCAAGAGCCAGTCACCGTTTGTCAAGGCGCTGTTCCCGGAGGAGCACGTCGGCGATGCAATGACGGGCATCCAGGGCC
GTCCCGCGGGCGGTGCTGCTGGTGGCGCCGGTGGGCGTCCGCAGCTCAAGCGCCGCACGTCGATCATCTCGGATACGGTCGGCACGCAGTTCAAGAGCCA
GCTGAACGGGCTCATGGAGGATATTCGCCGCACGAACGTGCACTACATCCGTTGTATTAAGCCGAACGGCCAGAAGAGCCCGAGCGTATTCAACAAGCTC
CGCGTGACCGAGCAGCTGCAGTGCGCCGGTGTGGTCGAAGCCGTGCGCATCAGTCGCATGGCGTACCCGAACCGTCTGCTGCAGACCGTGTTCCTGGAGC
GCTTCCGCGGCGTGGCGTCGACCACCAAGTCAGCGCACGCGATCGAGGATGTGGCGCAGGACGCGAACCAGTCGGACGAGGCCAAGACTGTCAACGCGGT
GCGTGACTTGCTCGCGAACCACTTGCTGCCGGGCAAGGAGAAAGAGTACCAGATCGGTAAGACCCGCGTGTTCTTCCGCAAGGGCGCGCTCGAGTCGCTC
GAGGAGATGCGTTCGCGCAAGCTCAATGCGGCGGCCGTGGTGCTACAGCGCTACGTGAAGAAGTGGGCGGCCATGGCGGCATTCCGCGTGATCAAGAATG
CGAGCATCAAGGTGCAGACCGTGTTCCGCGGCTACGCGATGCGCAAGTACTACCGCAAGCAGCGCGAGGCCGCGATCGTGATCGAGAAGCACGCGCGTCG
TCGTCGCGCGCAGCTGCTGCTCATCCGCCTGCGCCAGAACCACCGCGCGACCAAGATCCAGAACGTGTTCAAGATGTACGTGTGCCGCCGCAAGTACCTC
ACAGTCACCAAGTCGATCCGCTTGATCCAGAGCGTCGTGCGCATGTTCCTCGCCGTGAAATCCTTTGCTGTTCTTCAAAAGCAGGCCAAGGAGGACGCGA
AGCTTGAGAACCAGATCCAGCTGCTCAAGAAGCGTCTCCAGCAGGAGCGCGAGGCGCGCATCGAGCTCGAGCAGCAGGCGTACGGCCACCGCTCGTCGAT
GATCATGCGTAGCGAAGACGCGCTCGAAGACGCGGACTTTGTGATCGACCAGCTGCGCAGCGAAAACGCGGCGCTCAAGGAGGCGAACACAAACCTGAAG
ACGTTCAGCGCGCAGATGCGCAAGGAGAAGGAAGTGATGGAGCGCGGCGCGTACGTGAACGGCGCGTCGTTCGCCGCGGCGAACCAGCGCAACGCCAAGC
TCCAGGAAGAGGTGGAGCTGCTCCGCGGCGCGCAGATGCGCTACAAGGAGACGCACCGCATGATGAAGACGCAGAACATGGCGGCCATGGAGAAGCTCAA
GCTCATGCAGAGCAGTTTGAACGAAGCGATGAACGAGCGCATGGCGCTGCGCCAGAGCGTCGAGCACCTGAAGAACCACACGGAGCACCTGCAGAGCGAG
AACGTGGCGCTCGCCAAGGCGAACGCGCGTCTGCGTCTGATTCTGCGTCAGGACCCGGAGCTGAGCCGCAAGCACCGCGACGAAGTGCCACGCCTGACCA
AGCTGGCGTTTACGTCGAAGCAGCCGTCGCCACCGAAGATGTCGTCAGTCGCGAACATTATCAAGGCCGTGGAGCCGTCGGCGCCGGTTGTGAGCATGCG
CGTGTCGCTCTCGAGCCTGCAGCCACCGCTGCCTCCAACGCCAGCGGCCACGCCGGTGATCGCGGCGACGCCGATCAAGCGCNNNNNNNNNNNNNNNNNN
NNNNNNNNAACTCGCTGTCGATCTCGAAGAAGGCGGAAGTCGTCAAGACGCAGCGCGTCGTGAATATCCGCGAGGTGAACAAGGAAGTGGAGGAGGAGCC
GGTGGTCGAGAAGAACTTGAGCTTCATGACGGTCGTCGTGAGCGGCTCGGCGGGCAACAGTCTCACGAAGGAGCCAACCGCCACTACGACGACCACCACG
ACGACCACGACCGCTCAGTCTGCAAAGCAGCAGCCAGTATCCCCACAGAAGCTGCGCAGTGCCCTCGTGCGTCAGCCCACGGGCGAAGACGGTCCGATCG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTGCGAAGGTCATGGGCATCATCCTGGACGAGGACGACGAAGAGGATGACTTTGAGCAGC
GTGTGAGCTTCAGCGTGACGCTGGGTGTGGACTTGCTGGAGGAAGCCAGCAAGCAGCAGCAGCGCAACTCGCTAACCGTTGCGCCACAGCCGCCGCAGCA
GCAGTCGAACTTGCAGAAGAGCTAC