Transcript Name :
Albla_Nc14000570
Orientation:
(+)
Number of Exons:
5
Description :
conserved unknown protein putative
This protein is a Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Epidermal growth factor-like domain12.294PS50026
HmmSmart predictionP-Valprediction_id
Epidermal growth factor-like domain79SM00181
Epidermal growth factor-like domain95SM00181
Epidermal growth factor-like domain0.16SM00181
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5340.69428
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
KO ID
K06252
K06252
K06252
K06252
*** None ***
Sequence
        2599 bases(100 bases per row)
ATGAGCTTAAAACACGTTCTATTCGATCTCCTGTTGCTTACTTTTGCCATTCAATGTACGTAATATCGTACCCTCTATCTACCAGAGCTGTGAGAGCCAC
TAAGTTGAACCGTAGGCATCAGCTGGCATCGATGGGCCGCTGCGTCTGAGCCTGGGGCACGACGTGGTCATTCTATCCAATTTCACAACTCCCAACTGAT
TCTTTTCGGTGGTAGAGGGGAAGATGTCAATGTTACTCATATCCCCAAGACATTTGACCTCATAGAAGTCAATGGAACGCTATCGTTCGCAACATACGAC
GAAAAAGTTGTCTCCAAAACAAAGCCCACAAGCGTTCAGACTGGAAGATATTTCAACGATGTTTGGAGCTACGACATCAGTACGGGATTCGTATCCATCC
ACACATCCTGATCTCACTGCAATGTGTAGACTGCATACGATACGCCGGAGACGGCTGCGTGAATGGGACCTGGAAACGATTAACGGCAGCGGTATCGTGG
GGCGGCTGTTATATCGAACAAGGATCTCAGCTGTGCTCTTACCCTTCCGAGAGATGGTACCACCAGGCTCAGGTGTTTCCTGACGACACCATGCTCATCT
ATGGAGGTTTTGGGCCTCTGTGTCAAGATTACTGCGACGATATGTGGCTTTTCCATTTCTTAAACAGCTCCTGGACTCGAGTCGAGTCACCCAAAAGCGA
TGGAAATGGACCCGGAAAGCGCTTCAAGTTCTCGAGCGCTGTATCAGGCTTTCAGATGTACATTTTCGGGGGATATCGCCTTTGGCACGGCTTTGCAGGT
GCCAATTCCGCAGCAAATGACTGGTCCGATACGACTCAGTATCCTGCTGGAGGCTATCTGAATGATCTTTGGGTGTACGATAAGCCTTCCAACCGATGGA
GCAACATCACTGAGGAGCTAGTGTGCCCGGATCTATCTTCCATCGGAGAGGCCGTTGTGGATGCTATGGGTGAGGTGGAATGCACACTTGTGTGGCCACC
AGGTCGATCAGGCCACACCTCTGTGCTCTACAACGACGCAATTTACATCCATGGAGGCTACCGAACATTCTTCCCGTACCCGACGACGACTTCCGTGGGT
GCAGGACGAGGCAGAACTACAGGTTCCGGAGCTGGATTCAAGCCGTACCCCACGCATCCGTACTTCCTAGATGACTTTTGGAGCTACAACCTCACCACCC
GACAATGGAATCAAATCCTTCCGCCGTATCGAGGCGATAGAAAGAGGAATTTTGAATATCAGGAGATCCCAGAGGCTCGCATGGGGCACTCTATGGTGGT
TATGCGAGATATCTTTGTGTTATTCGGCGGGTACAGCACAAACCATCACTTTGACGACACTTGGCAGTATTTCGTCTGTAAGTAGCGGCTTCCATGTGAC
TCCATCCTCTCCCTGATTCATTTGCGGTCTCAGCAAGCAATCGATGGAGTAAACAGACGGCTTTTGTGCATGCAAAGTATCCCTTCTCGTGCACAGACGA
TCTCTGGGCCCGAAAGCAACCCCACAGCGGAATGTATGACGCTTACATTCCGCCTATAGATCTCACCAAAGGCAGCTCATTCAGCACAGAGCTGTTCTAT
GGAACGAAGACGGTAAAGACTCCATGTGTCGCGTTCACGCTTGCGTCTCATACATGCCTGTAGCTTTCCGTGTTTGCAGAGCCTACACGAGGCAGCAAGG
CCGAGCCTTTGCTCATTCCACAAGCCCGAAGACAAGCTCCAGGATGGGATGGTTGCCGGGATCGTGATGATGGACGGAGTGATCTGCCTCAGGACTTGGA
ATGGGAACATCCTTCACAACGATCGGGTCACGCATCCGCGTCCCATCCCTTGTTTGACGCCATGTTTGTGTATGGAGGAGGCGGATACATCCGAGAGGAA
AAGTATCATCCGCTGTTTACGCCTGAAGAGCGTTCTCAGTCGGATTTCTGGCACTATAAACCCACAGAATGCATCAAGAACTGCTCGCTACACGGAGTGT
GCAACTATGGAAGCTGTCAATGCGAAGACGGGTACTACGGAACGGATTGCTCCAATACCTCGTGCCCCGGGACCTATTGCACCTATGACGAAAACCTTGT
GGAGATCTGTGATCACTGCTGTTTCTCGACAAATTATCACACGGAGAGTGACTCGTACGTGGAAGGCGTCCAGAAGTATCCTTGCACGAGCGAAAATGCT
CATTACTCGCATGGAATTTGTGACGGATTTGGCAAGTGCATTTGTGAGCCTGGTTTTGTCGGTGAGGACTGCTCTATTCGAGACTGCCAAAACGATTGCT
CCGGGAACGGATACTGCTCCTTAGAGTTCCCAAACGCCAGGTGTATGTGCGACATCGGATGGTATGGGATGTACTGTGAGAAGCAATTCTGTCTCAACAA
TTGCTCCTATCCGAACGGCGTTTGTGTGAATGGGAGCTGCTACTGCTCCATGGCGTATGACCCGTATAATAACACGTGGGAGTACTTCCCACTGATGGGA
GAAGACTGTTCGTTTTCTCTTCCTTTCGCTCGAGCAGAGGAGGAACGCCCGGTCGATACTTTGTGGGCCTTGACGCTTTTTGCGCTTTGGTTGTTGTAG