Transcript Name :
Phyag_g1744
Orientation:
(-)
Number of Exons:
3
Description :
notchless family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
G-protein beta WD-40 repeat9.7PR00320
G-protein beta WD-40 repeat9.7PR00320
G-protein, beta subunit4.6PR00319
G-protein beta WD-40 repeat9.7PR00320
G-protein, beta subunit4.6PR00319
G-protein, beta subunit4.6PR00319
Profile scan predictionP-Valprediction_id
WD40 repeat16.958PS50082
WD40-repeat-containing domain70.763PS50294
WD40 repeat13.416PS50082
WD40 repeat12.781PS50082
WD40 repeat11.712PS50082
WD40 repeat17.092PS50082
WD40 repeat16.19PS50082
WD40 repeat14.418PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat3.1SM00320
WD40 repeat2.6SM00320
WD40 repeat0.0036SM00320
WD40 repeat3.8SM00320
WD40 repeat0.11SM00320
WD40 repeat6.3SM00320
WD40 repeat3.6SM00320
WD40 repeat0.003SM00320
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
G-protein beta WD-40 repeatIPR020472
G-protein, beta subunitIPR001632
*** None ***
InsideOutsideTMhelix
1-510
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1679 bases(100 bases per row)
ATGGCCACGCACGttgccaagaagatgaagctggagcaCGAGCCCATCAGCGCGGACGCCGATGCAGCTATGAAACCAGAGGACGCTAACGCCAGTGGTG
ACGACTCAGACTCAGAGGATGAGACGGGAACGTCCGCTATCGCCCAGTTCCAGAGCGAAGACGTGAGCTCCCAATTGACACATTTGCTTTTGTGCAGGAT
AAAACCCTTACGTTGTGTGCGCATTGAATAGGGAACCAATGTGGGTCCGCAATTGGAGATCCCCATGACTTCCAACGtgaagcagatggaggagctggtc
aatgaattgctgcagaatggCAAGAACCGTGTGCCGTACTCGCTGTTCATTGGCGAGACGGAGGTGACGACGTCACTCAaggcgacggtggaggagtTGG
TGCGTGATGCAGCAATGTTGCAATTGGTGCGCTGTATTACTTGCAAGTTGCTGACTTTTTTGGTGTTGTTTTTTAGAAATTGTCgacggagacggcgctg
ACCATCACGTTCCAGCCGCTGGCAGCGTTCCGTGTGCGTCCTGTAACGCGTTGCAGTGACACGTTGCAGGGACATTCGGAGGCTATTCTGCACGTGAGCT
TTAGTCCGGATGGGAAGAGGTTGGCGagcggaggaggtgacgcGACTGTGCGGTTCTGGGACACCAACACTTGCATGCCGAAACACACAGGACGAGGACA
CAAGAACCACGTGCTGTGTACGGCGTGGTCGCCGGATGGAGCGCGCTTTGCGTCGGCGGACCGTAATGGTGAGATTCGCTTGTGGGACCCGCTGACGGGT
AAGCAGATCGGCCAGCCCATGAAAGGACACAAGCAGTGGGTGAACTCGTTGACGTGGGAGCCGATGCATCGTAACGCCACTTGTGAGCGATTCGCGAGTT
CTTCGAAGGACGGATCGATTAAGGTATGGAACGCTCGTACAGGTCGATCCATTGCTTCATTGTCTGGCCACACAGACTCGGTGGAGTGCATCAAATGGGG
AGGCGAAGGTTTGCTGTACAGTGCGTCCCGTGACCGTACCATCAAGGTTTGGGCGATGGAGGGCGAGCACGTGGGCAAGCTCGTGCGTACATTGATCGGA
CACGGTCACCGTATCAACACGTTGGCGCTGAATGTGGACTACGTTTGTCGTTCGGGTCCGTTCGGCCACAGCACGAAGAGCTTCGCGTCGCGtgaggaga
tgcaggaggcggcgctgaagCGGTATCAGGAGGTGCGTAAGGGACAACCGGAGCGTTTGGTCTCCGGCTCGGACGATTTCACGCTATTCTTTTGGGAGCC
ATCGGAGAGCAAGAAGCCGCTGGCTCGCCTCACaggccaccagcagcccgtgaACCACCTGAGTTTCTCACCGGACGGACGATACTTCGCCAGTGCCAGT
TTCGACAAGAAGGTCAAGATCTGGAACGGCCAGACCGGCAAGTTCATTGCCACGCTCACGGGCCACGTCGGCGCCGTGTACCAGGTGTGCTGGTCGAGTG
ATGCACGCCTGATCGTGACAGCCAGCAAGGACTCGACCGTGAAAGTGTGGGAGCTCAGTGCTCCAAAGAACGCCAAGACGACACTGTCGGGCCATGCTGA
CGAGGTGTACGCGCTGGACTGGAGCCCCAACGGCGACATGGTGGCGTCAGGCAGCAAGGACCGCACCATCAAGATGTAA