Transcript Name :
Pytir_DAOMBR486maker-pir_contig_285-snap-gene-0.20
Orientation:
(-)
Number of Exons:
10
Description :
Telomerase reverse transcriptase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Telomere reverse transcriptase1.3PR01365
Telomere reverse transcriptase1.3PR01365
Telomere reverse transcriptase1.3PR01365
Profile scan predictionP-Valprediction_id
Reverse transcriptase32.675PS50878
Immunoglobulin-like domain7.54PS50835
HmmSmart predictionP-Valprediction_id
Telomerase ribonucleoprotein complex - RNA-binding domain1SM00975
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1135
*** None ***
PositionContextScore
233RHFRKKR|VF0.667
372ERKRKRR|EQ0.508
626PVDRNQR|SV0.51
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
DNA bindingGO:0003677IEA
RNA bindingGO:0003723IEA
nucleusGO:0005634IEA
RNA-dependent DNA replicationGO:0006278IEA
KO ID
K11126
*** None ***
Sequence
        4398 bases(100 bases per row)
ATGCGGGGCGCGTTAGCAGCGCTAGTGCCGAGCGGCAAGACGTTGCGCGCGTTCCTGCTCAGGTGCGCTTACTCACAGTGCCTCATAGTGTGTCTCTTGT
GGATCCTAGACCAGCTGTGTGCACTTGTGTGTCTCTTTGTGGGCTTTGACGAGTGCGCTTGTGGCTGGGTTTTGGTTTTCTTTCTATTTGGTGACAGTGC
TGCTGCACAACAATCCGTGAGCCACGATTCCTCCACTGCGCTCAGAGAGCGTCTTGCAGCGATTCTGTGCGCAGAGACCGCGTTCCTACTGGAACACACG
ACCGTGGCTCTCTACACGACGCAGGAACTTCCGCGAGCGCCGTGGGGTGTCTCGACGTCGCTCTCGTTTGTAAGGACTTGTTATATTTTGCTGCGAGCTT
TCGTATTGGCGTACCGCAATAGACTAATATCGTGGTTGTATCGGTATGTCTTGCCGTGTATGCCGTGCGCAGTCTGAGCTGGTTCATCTCGTCATTGAAG
TAAGGGATTTCTATTGCAATTTGCCTATTGAAACATCTCTGTCTCGGCTAACCTGACTGACCTGACGATGGCTACATCCACTTCATACAGAGACTGCTTA
TCCGAAAGCGATTGAATCCAGATGACTCGAATATCCTGACGCTTGGGTATCGTGAAGTTGCGCCAGGTCTCTCGGGTCACCGCGTCTCGTCGTCGAATCG
CATCATGTGCTACTACCCAAACACGCTGGTGGCGCTGCTCAAGAAATCGTCTTCTTGGCAATTACTCCATTCTGTGATAGGAGATGATCTGATGCTTCAC
TTGTTGATGCACCACGTCATCGTCATGGAACTACAGGGGTCCAAGCACTCTTATATCCAGGTGCTTACCACCGATACTCGCTGATATGACAGTTCTCAGT
ACCTTGGCATGAAGTTTTGACGATCTCAATTACGTGGGGGGTTTTCTTTGCTGTATAGGTGGCAGGCAAGAGCTTGCGCCAAACATCCATGCAGTCATTC
GTCAGCAGCAATGCAAGCAAACAACAGCAGCAGCTGCTGATAGGATCCAGTACCATCAACAACCCCAAGCAGCCTAGAAAGGGCTTCCCGATGAAAGACG
GCGTGATCTCAATCAACCAGGTGCTCTATGCGCGGCATTTCCGCAAGAAACGCGTCTTCTCTGGCTCCCATGAGCTCGTGAAAGCGGCAAAGAGCCCAGA
GATCTCCAGTGGGGTGGTGGGGCGGCTCATTCGGACGATATTTTATCGGGACGACGCGAAAGGAAGCCAAAGCAAGCGTTTGCCGAAACGGCTCATCAAC
CTTGTTCCGATCATCCAAAAACTGATAACCCGCTTTCGAGACTTGGATGTCGAAGCCTTTACGAAGAGTGTGCTTCGAATCCCACCCAAGTTTCGAAAAT
TCATGCACGAAAATCAGAAGCTGAAAGGGATCGCAGCGAGATCGCCCAGCAAATTGGCGCCCAACAGTCTGGAAGAGATTTACGCGATGGAAGTAAATGC
GCTCAAGAGCGAGTACTTGAGCCAAGAAGACAGCGACAGCGCGCAGTTTGAGCGAAAGCGCAAGCGGCGAGAGCAGGCAATCGAGTCGCGATCGTGTGCG
TCAGCTGCTGTATCTGAACCCTTGCTACCACCCAGCTCAATGTCGAGAAAACGACTACGAATGACTGCGAATCAGGTGCCAATTGCTGGGAGTGCCTCAA
AAAGTAGTAGTGATCTGACAAAATTGCGCGAGCATCGGGACGAAATTTCCCAGTTGGGGGAGTTTGTCGTTCCGAAGAAAGTGGTTTTTCGACTGCTTCG
GAAGTTTGTCGCGCAAGTTATCCCCAAAGAGATCTGGGGGCAGAGTACAACGAAGAACTGGGTGTGCGTCAAGAGCCTTCTACAGCGGTTTGTGAATTCG
CGAAAGTATGACGTCATGTCGCTGAAAGAGGTACGCTGTTCTTCCTCCTAAAAGGGCTTTGTCATCTGTAGAGATGATGCCAATGCTAACAATGATTTAT
TGTGAATAGTGTTGTAACGAGATGCAAGTGAAAGGTGTGGAGTGGATGAATACCCAGGGAAATCCATCGAATTGGTTCGTGCACACATTATCACTGACTG
TAATCAACGAATTTGTGCCGCATGAGATTAATGTGCCGTTTCTGTATCTAAAGCCCTCCGAACGAACTGCTCAAGCGCCAGGAACTCTTCCAAACGATCA
TTACTTGGCTGTTGAAGAGCTTGGCGTTCCCATTCCTGCGGAACCTCTTCTACATCACGGAGCGCGAAGGAGCGTCGAATGAGATCGTCTACTACCAGCG
TGAAGTCTGGGATGTCATCAGGTTCGTATTGCTACGCGCATTTTTCGATGCTACTCTATTTCGAAAATATGATCACTGACTGCTCACTTTTATAATCCGC
AGCAATGTGGCAGTGCACGACCTAAGCGCTGGAGTTCTGCAGCCCGTCAACAATGTCACTGTACTAGAGCAGCCCCGGCAACTAGCGACCTCACGACTTC
GTTTGCTTCCGAAAGTGAGTGGCATCCGCCCGCTGATGAATCTCTCGTCTCCAGTCGACCGTAACCAGAGATCGGTCAACAAGGCGCTTGAGCCTCTGCA
CCGTGTGTTATTATTCGAAGCAGATCGTCAAGCAAAGCAGCTTCTTGGTTCAACTGTGCGCAGCATGGACGAGATCTATCAGCGAATCAAACCACTGTTC
AGCGGCATGGCAACATGTAAGAGCTGCAAAGAGCGCCTTCAAGGAGATCAAGCACCGCCTGCGTTATACTGCGTGTCCGTGGATATCGAGCGGTGCTTCG
ATACGATCCGTCCTCGCAAGCTCTATCGAATGCTCAAGAAAACCGTTTTAGAAGACGAGTACTTGATACGGAAGCATTGGGTCTACCAGCGGAGCAATCT
CGTCAACATAGGCAGCAGCAAATCTAAACGAAAGACGAAAACGTCACTGGTTTTCAAGATAGCGCGCCCCGCATTCCGATCTGGTGACCTGCAAGGTTTC
GACGAGCTGGTGGCGAAATCCAAAAAGCGGAATGCTGTTTTCATTGACGGTGTGCTCTACGACTACCTGCCGAAAGTCAAGCTGCTCAGTTTGCTGAAGG
AGCATCTTCTAGGGAACATCGTACAAATCGACGACCAGGATTTTGTCCAGAAGCAAGGAATCCCGCAGGGGTCAGTGTTGTCAACTCTGCTCTGCAACCT
TTACTACGCGAACTTTGAGCGGAAAGTGATCTGGCGGCGTCTCGGCAAATTCTATGCAGCTGCTATTGTGGACGACTCGAGAAGTTCTTGTCACCATGAA
GAACTGATGCGCTACACTGACGATTTCCTGTTTGTCAGTACGAATCTGAAGCGTGCCCAAGCGTTTGCAAAGCTCATGCACGAAGGTAACGCGGACTACG
GATGCTCTGTGAACTTTGCAAAGAGTCGCGTCAATTTTGAGGTATCCGTGAAAAATGAGAAAAATGTACTTCGTGCGATTCCGAGGTTTGACCAAGATCC
AGATGACAGAAGACTCGGTTGGTGTGGGATGCTCATCGACCCCATCTGCCTTCAAGTGTACGTCAACTACGAAAAGTAAGTGGTCATGTGAAGTGTGATG
TAAACTATGGGTCTTGCTGTGGAATACTGAATCCTGGCATGGTGTTGTGGAATACTTTAGCTCCTTGACCCAGGCATCGATTCCTTTCGATGAAACCAAG
GCTCTCCAGGATTTCTTTGTCAACAAGGTGCTCTCGTCGATCCGACAGCGATGGCATCCGCTCTACTTTGACTCAGCATATCTTTCGAAAGAGACGATCC
AGGTATGTGCATGTATGCAAATCGTCTAGAACCCTTGGTGAGGCTTTACTCTGATGAAAATGTGGCGTTGAGGTTTTCTTTTGTAGGTGAATCTGTTTCA
GATGCTCTGCCTCGCTGCAGTGCGCTTTGCGCTGATCGTCGAGATGCTGCCGTTCGTGAACCACAAGAACATCAAATTTTTCTACCAAAGTGTCCGCGAA
ATCATCGCAAAAACCGAGAAAGGCGTCAATCGGTGTCTTCATGGCGCTAGAACCAGTCACGATGCACTGGTGAGAGTCAAAGGTGCTCAGCATGGAGGAG
ATTACTCGAACACGACTCCAATAAATGAGACGGAACAAAGTGATTTGGTGAAAGACAAGAAACAGACCAAGACGCGCAAGAGCTTGCCGTTTAACGGTGT
ACAAAAATACGAGGTAACGCGAGATGATGCTATCGTGGCATATATTGCTCTCACGGTCACTTGTAATTGGCTGCACTGACTGCTGAGCATATTCGCTACA
ATTTGAATGTAATGGTAGGTGTGGTGCATTGGGCTGCAAAGCTTTCAGCTTGTGCTGCAGAGAAAGCAAGCACGCTGGAGAAAGCGGACGACGGATAA