Transcript Name :
Pytir_DAOMBR486maker-pir_contig_217-snap-gene-0.20
Orientation:
(-)
Number of Exons:
2
Description :
Cysteine protease family C01A
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase C1A, papain C-terminal9.1PR00705
Peptidase C1A, papain C-terminal9.1PR00705
Peptidase C1A, papain C-terminal9.1PR00705
*** None ***
HmmSmart predictionP-Valprediction_id
Peptidase C1A, papain C-terminal1.5SM00645
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6120.67222
InsideOutsideTMhelix
469-494
1-445
446-468
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
cysteine-type peptidase activityGO:0008234IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        1564 bases(100 bases per row)
ATGCGCGTGACTTCATTCGCTACGCTCGGCGTATTTGCTGCCGCAATGGACATCGCCACGGCCGCAGACAACTCGGTCGGCACGCTGGTGAGCTGTCCAC
ACGGGGGCGACGCCTCATGCCTGTGGACGGGCGAGAACGACCAGGTGATCGACGCACAGGCGCTGCGCAGATTGCTGCTCGCGCAAAACAACGTGGACGA
GCGCGACGCCGAGGCTCCGCTGCGCAACCTGCAGCGCCACATGGAGTATATCGAGAGTGCGTCTTGTTTCGTTTGCCTGTGAGGGTGGGCTGAGTGTACA
ATGTGCTAACTGGCTGATTTATTTTGCATGTGTAGATGTCCACCGCTATGCGCAGAGCGTGGGTCATGCGTTCACGTACAAGATGGGTGTGAATGGGCGC
CATTTGTTCGACACAACGCCCCGAAAGCACTTGCCCGAGGCTTTTGTCCACATGGAAATGCGCGCTGGACCCAAAGTGTCGTCAGTGCGGCAGCTGTCGA
CAATGGCCACGGGCTCGTCGAGTTCGAGCACCACAAGCACGAGCGACTTCAACTGGTGTACAACAGCGAACCCGCACAATCACAGCGTCTGTTCGGCCGT
GAAGAGTCAGCAGAACTGCGGTAGCTGCTGGGCGTTTGCCGCCACAGATGCGATCGAGACAGCGGTGGCGATCGCTGCGAACCAAACCGCGGCGGTCGCG
CTCGCGCCCCAGCAGTTCCTGTCGTGCAGTACGCGCGAGACCGAGCAGTCGTTCACTTACTGCTGGGCGTCTGGAGGTGTCAGTGGCGTGTCGTGGCTCA
GCGAGACGATCAAGTGGAAGTCCACGAACAACGGCTGTGACGGCGGCATGACCCACGGCGCGTTCATGGACGCAGCGCAGCTGCAGTACGGGCTCGTGAC
TGAGCTGGTGATGCCATACAACGACCAATCCGCGTCCAGTAACACGACGTGCATCCGGACGTCGAACCAGACTGCGGCGAGCATCTCGGACTGGAAACAG
GTTGTCGGCAAGGACTGCTCGGCGAGCAGCGACCCGAGCGTGCTGTTGCGAACCGCGTTGCAGGAACAGCCGATCGCCGTGGCGCTCAACTCGGACGATC
CGTTCAAGGACTACAAGGGCGGGTTTTACAGCTGCCCGAACGACGGCGACCTCGCATCGAAGGACGATGTGAACCACGCGCTGCTGCTGGTAGGGTACGG
CACGGACGCGACTGTGGGGGATTACTGGATCTTGAAGAACTCATACGGTAGCTCCTGGGGCGATAAGGGGTTCCTGAAGCTCGTCGCGGACAAGAAGGCG
AACTGCGGACTCAACATCTTTCCCGTGGTACCTGTGGGCGCGAAGGCTGGTGTTGCGACTGCAGTGGTGGACGGTGGCGGCGACAAGGTGTTTGTCGGGA
TGAGTCCGTCGACGTGGATCGCGCTCGCGGTGATCGTGTCGATTCTCACGATCGTGCTCACGGGCGTGGGTCTCTTCTGGGCGAAGAAGAAGCGCGCGGT
GCTGCGCGAACAGGTGAGTGGCGCCTCGATCTACTTGGCTCAGACGCCCGTCGTGCACGATTAG