Transcript Name :
Pytir_DAOMBR486maker-pir_contig_217-fgenesh-gene-0.1
Orientation:
(+)
Number of Exons:
3
Description :
Mitochondrial Carrier (MC) Family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Mitochondrial carrier protein2.7PR00926
Mitochondrial carrier protein2.7PR00926
Mitochondrial carrier protein2.7PR00926
Mitochondrial carrier protein2.7PR00926
Mitochondrial carrier protein2.7PR00926
Profile scan predictionP-Valprediction_id
Mitochondrial substrate/solute carrier17.042PS50920
Mitochondrial substrate/solute carrier26.525PS50920
Mitochondrial substrate/solute carrier24.766PS50920
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Mitochondrial substrate/solute carrierIPR018108
*** None ***
InsideOutsideTMhelix
1-272
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1056 bases(100 bases per row)
ATGCTCTCGACGAATGTCGGCATGGTCTCGACTGCGACGACGGCAGCGCGGCAAGAGGTGCAATACACGGGCATGGTCGACGCGGTGCGGACGATCGTGA
AGGAAGAGGGCCCCGGCGCTCTCTGGAAAGGCGCAACCCCGGCGCTCCTGCGTCAGGTGTCGTACACGAGCATCTGCATGGTGCTCTACGAGCCGCTGCG
CGATTTCTTTGGCGCGAACAACGCCAACAAGAGCGAAGTGCCATTCGTGAATCGTTTCCTCGCCGGCGGCTTTGCCGGTGCGATCGGAATCACTGTCGCA
AACCCGTAAGTGTTTGCATTTCTATTCTGTATGTGTCTGTGTGTGTGAATGTGGTCATGTTGTTGTGCCACGCGTCGTTTTGTTGAGCTGTTCGTCACTC
ATCTTTGTATCTCTCTGTGGTCGACTATCGATCTGATTATGATATGCCAACAGAGTGGATGTCATTAAAGTACGCATGCAGGCAGACCGCTCGGGCACGC
TCTACCGCGGTGTTGGCGACGCGCTGACCAAGATCTACCAGCGTGAGGGCATGCGCGGCTTTCTGAGGGTATGTTGCTACCGCTATTGTTGAAATATATT
ATTGCTTTACCATGACGCATGCACTAAACGCTATCCACATGTATCATCACAATGCAGGGCATGCCGCCGAACATCCAGCGCGGCTTCATCGTGAACGCGG
CCGAGCTCGGCACGTACGACCACAGCAAGGAGTGGCTGATCACGTCAGGTTTGCTATCGGATGGCGTGTTTGCGCACACGGGCGCGAGTTGCGTTGCGGG
CTTTGCCGGCGCCGCGGCGTCCAATCCGATCGACGTGATCAAGACGCGCCTGATGAGCCAGCCGACCGACGCCACGGGCAAGGGCTCGCTGTATGCCGGC
ATGGGCGACTGCGCCAAGAAGACGTTCCAGGAAGGAGGTGTGCAGGCCTTTTACAAGGGCTTCATTCCCAACTGGATGCGCAAGGCGCCGTGGTGCGTCA
TCTTCTTCGTCACCTACGAGCAGTACCGCGCGGCGCTCTTTGACCAGGAGGAGTGA