Transcript Name :
Pytir_DAOMBR486maker-pir_contig_212-snap-gene-0.22
Orientation:
(+)
Number of Exons:
2
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-409
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1327 bases(100 bases per row)
ATGGGCAACAAAGTGATCACCGGCGTGTGCACGCGCGACGACAGCCTCGACGTCGGTGACCTCTCGGGCGCGAACTTTGACTTCATCTCAGTCGCGATGC
GCAGCGGTTCGACCTGCGCGACCCCGAGCTCCCGCGCATTCGTGCCAGCCTCCAAGATGGTGGTCGCCGTCGTGCCAGTCGACTTCAGNNNNNNNNNNNN
NNNNNNNNNGTCTCAACTTAAGTCACCACCACAGCAGTTCCTCCCCCTTCGACAAGGTAAGTACGAAGCCAGCGACACGCCAGACCTCCTCGACCACCAT
CACTACTGCCAGCTCTCCGACTCCAACTCCAGCCAGCGACGACGAGCCTGAACTGAGCTTCAATGACCGCCTCAACAAGCTCACGTGGGACCCCGAGGAC
TTTGCGCTCCCGACTCGCGCCATCAAGCACCAGAATGCCGTCTGTACTTCAGAAGCTTCTATCTCCAAGCCGATGTCAATGTGGAGCGCCACCCGCCAGC
CCGCGACGACCTCGCCAGAACCCGCGCAACGGAAGTGCAAGACGCCGTTCAGATGGCTCTCGCGCACCTTCAGTAGCTACAAGAGCTCCGCCGCGCTGAA
GAAGCAAGCCGAGGATCTCCAGAAGAAGACGAGACAGCAGCAGCAGCAGCAAGACGACCAAGACAAGCAGCAACAGCAGGAGACAACGTTCAAGACCCGA
GCCTCCTCGATTAAGACCCAAGCGATGACCAAGACGATTATCAATCACGACCAAGATCAAGAACCACCAGTTGTGCAAAAGATGGAGCAGCTCGCACACG
ACGACCATATCAGTTGCGAAGGCCCAATCTCTGATACCGAGAGTGAGTCCAGCGCTACGGAGCTCTCGTTCCCCTGCGGTGATGTCTCCCCCTCCTCCCC
CTCGACTATGTTCGCCATGGCGTTCAGCTTCTTCCGCAAAGAGCCGTTCAGCGACTCGACCGGCTTGTGCGAGACCTTTGACAACGAACACGACGACAGT
GACGACGACCACGTCTCGCTCGTCTACTTATCTTCCTCAGTGAACACCTCGACCGTCAAGATGCGCGGCTATCTGTGCGACTGCAGCAGCTGCCCAGCGT
ACCGCGCGATTGAGAGAGAGGTGACGACTTCCACTTGCTGGATGAACGAGTGCGAGCGACAGAGCATCTGCCGCATCCTGCAGGCGTATTCGACCTACAA
CGAAGCCGTCGGGTTCTCGAAATCCATGGTCGCGTACGCGGAAGAATGTCTACTGGTGTTCCGTGGTGACGAAAATGCGGCGTTCAACGCATTCGTGCGT
CTTGGTCAGGAGAAATGGGAAAAGTGA