Transcript Name :
Pytir_DAOMBR486snap-pir_contig_92-abinit-gene-0.107
Orientation:
(-)
Number of Exons:
1
Description :
Pentatricopeptide repeat-containing protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pentatricopeptide repeat5.393PS51375
Pentatricopeptide repeat9.843PS51375
Pentatricopeptide repeat9.547PS51375
Pentatricopeptide repeat6.654PS51375
Pentatricopeptide repeat6.149PS51375
Pentatricopeptide repeat5.009PS51375
Pentatricopeptide repeat7.278PS51375
Pentatricopeptide repeat9.065PS51375
Pentatricopeptide repeat9.712PS51375
Pentatricopeptide repeat10.731PS51375
Pentatricopeptide repeat6.993PS51375
Pentatricopeptide repeat6.555PS51375
Pentatricopeptide repeat7.936PS51375
Pentatricopeptide repeat6.095PS51375
Pentatricopeptide repeat5.24PS51375
Pentatricopeptide repeat6.84PS51375
Pentatricopeptide repeat5.382PS51375
Pentatricopeptide repeat5.623PS51375
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pentatricopeptide repeatIPR002885
*** None ***
InsideOutsideTMhelix
1-1223
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3672 bases(100 bases per row)
ATGCGGCTTCCATCGGCGCCGTTCCTCCAGGCGCAGCGTTGCCTGCGTCTTGGAGCATTGCGAAACAGCAGTGGTAGCATCAGCAGCAGAGCTCTCGTGC
TCCACAGCGCATCACGTTGCAGGTCTTCAGTCGGATGCACAGGCCCACCACAGTGCGCGGCATTCGCGACTTCCTCGTCACCATCCGCTCCAGCGTCATT
GTCGCAAGTGCTGCTGCAAGACGCAGTCCATCGAGCTCATGACAAGACTGGTAATAATAAGCATACTGATTTTGCTGGCACAGCTGCTGCTATCGCCACG
TCGCGTGAAGAATTGCTGGCAGTGATCGGATTGGAACACAACCAGAGCAATACCTACTACAACCAGCACCTGCGAGTGGCTCTCGATCGCAAGGACGTCC
GCACTGCAGCGCTGATCGTTTCCGCATTGCGCGCGCCGAGTAGCAGCGACAGTGCTCTATCGAATGCAACGATTGACCCGTGCAAGCCTGTCATTTGGAC
ACAAAACTATGATGCGCTGCTGTTCGAGTGGAGCCAACGCGGGGATGTGAACCAAGTGCTCGCGCTCCTCGACGAGATGGTCGCGTTCAATCGCGTAAGC
ACGCGCAGCTTCAACACAGCGCTGGTGGCGTGTAGTAAGAAGCGCAAGCTGAAGCAAGCGGCGCACGTGCTCCAGCAAATGCGCGAGGCAGGCAAAACCC
CGGGGCCGTTCGCGTACGCAAATGCGATCAACTGCTGCTCCAAGGGCGATGGGAATGTGAAGATGGCGACCAAGTTCTGGAACGAGATGCTGCATGATGG
CGTGGAGCCGTCTATCGAGGTCGTGAATTGTATGCTGCGCGTGTACAACCGAGCGGGCGGTCGCTCCCATGAAGCGCAGGCGCTGGTGCTCCAGGCGATC
CACACATTTGATCTGACTCCCGACGCGATTTCCCAGTCGGCGCTAGTATTTTCGTTGCTTCAGGACGCGAAAACGGGCGACGCAGTGGATTTCCTAGAGG
AAATGCACGAGCAAATGCAGGTGAAAGTTGAAATCGACCTGCTCAACGCCACGCTCGACGCCTGCAGGCAGCTGGAAGACTGGGAGAATGCAGCGAGAGT
GCAGCATCTGATGCAAGGATCACAAGAAAACAACAGTGGTGGCAGTGGCAACGCTGTCACAAAACGGTTGGTTGCGCTGTGTGAAGTGAAAGATGCATCA
TCGCCCGCTGTAGCGTGGACATTTGCAGCTCCGCATCAACTTCCGATCTCTGCACGAGCCAAGCAGAACGAGATGGTAAAAAAGGAGAAGCAGAGCCCAG
AAAAGCTGCGAAGAGTCTTCCGTGAGATCATAGCCACACTGGAGAATGGGTGTGAAGACGGCGAAGGTGCGTCGTCGATCCTGAGAAGAGTCGAGAACCT
GAAGCAGTGGGAGCGGATCTTCACGTCGGCTCTGATTGAAGACGTTGAGAAGTTCATGTGTTTGTGCCAGAAGCTGGAGGCCAACAACGAAAACAGCGAG
GTTCTACTGGGAGTCGAGTTCTATAACCTCTATCTCTTTGCGTTGTCACGACACGCTGGTAGAATCGAGACGGCGCTCAGCACGCTGGACGAAATGATCG
AGAGGCAGCGTGTGGATGCGACGAGCTTCAACAACGTGCTAGCGATGTGCAGTCGACATGGACGACTCGAGTTGGCAGAGCGAGTGCTGGAGAAGATGAA
GCTTGCGGCGCGATGTACGCCGTCGACTTTCTCCTACAACGCGGTCCTGAATTGCTGTGCGCTTAAGTGCGATGTGCCTAAGGCAGAGCGCTACTATGCA
AAACTCAAGGCTCGCGGGCTTTCACCAGACGCAGTCACCATCAACACGATGCTGAAAACTTATGCAAGCATGACGAAGAAGGTGTCTCAGAGACACCATC
TAGACCTACGAAACGAAGAAGAAGGAAAGCCGGAAGGACTCAGCTACGCCCACCGTGCGCTCAAGCTCTTCCAGCGAAGCTCCAGAAAGCTCAAGATCGA
ACCTTCGAAAGCGACGTACTTCTCGCTTTTCCGCGCTTTTGTGCAGGAAGCAGACAGGATCACTGCGTTTGAGGAGGGCGCAGAGGAAGACGGAGACGGT
GATAATGACGAAGGGATCCACGACCAGATCTCTTTATTAATCAAGCGAGTTTGCGTCGACGCGCCTGTGAAAAACCTGGACGTCGCAGTGTTTAACGCCG
CGATCGACTACTTCCAGCGCCTGGGGGACATGAAATCGACGTTCGACTTGTTCAACACCATGAAAGAGAGAGGCTTCGAGCCGAATGACATGACGCTGAG
CCTGCTGTTTGCCGTGTGCAGTCGCTCGGAACAGATCGACGTGGGGCTCAATTTTCTGCATTACCTCATGGACGAGCAGGGCTACAGCCCGACGATCGAC
GTGCTAAATGGCGCGATCCAGCTGTGCGCCAGCTCGAGCTCTCCGCACGATGCACTGGAGCTGTTCAACGGAATCCAGTCGTCGGGTCTTCTAAAACCAA
CTGAAGCCACATTTGTGAACCTGATCCACGCGTTTGGCCGCCAGGGCGATGTCGCGCAGGCGCTCGAGTACATCCATGCGATGAAGCAGCAGCTTGGATT
TGCCTCTCTTGACGCGTACAATCGCGTGCTTCAGGCGTGCGCTGTCAACAGTGCGTCATTCCAAGCAATAGACGTGTTGCAGCACATGCAGCAGCACGAA
GGGTTGATTCCGAACGCTGTGTCCTACAACATGGTGCTCAAGGCGTTCGCGAAGGTGCGCAGACAAGCTGAGGATGACGAGAGCGATGACGAGGGCGATG
ACGAGGGCGATGACGAAGAGGACGACCAACAAAGTGGTGACTTTGATGATGACGACCAGAATTTTGGAGCTGCTGGTGAAGATGCTTTTGACAGTGTTGA
AAAAGAGGAACCTGAATTTTTCAACGTTGCTGACGCCGAAACTCGTCGCGCGGAGGCTGAAAGCGTGCGGAATCTGTTGGTGGAGCTCCTCGACGAAATG
CAGAGCAATGGCGTCCCGCCGTCTTCGATCACGTACACGCGCGTGCTCGCAGCGTGTGCGCTGCGTGGGGATACCGACGGAGTGCTCCAGTTTGTTGATG
AGCTACTACACAGCAAAAGCAATGGCCGCAGTGCATCCAGTGAAGTCGTTGAGCTCCTTTCCGAGTCGAGTCTCCAGAACTACCTGAAAGCCTGCAGCCG
CGCGCGCAATCTTGATCGCGTGATGCGCTTGATGGGCATTCTCCAGGAGTGGCATTCGGAGACTGGCAGATCTGTCTCGCCGCGCGTAATCCTGCAGCTA
CTCAACACGCTGGATGATCTGGGGGCGTGGCGCCGCGCGGTGGTGGTGTTGCGTGACGTGGAAGCGACCTATGGGGTGCGTCCGAACGTGGTGTTTTTCA
ACCGCGTGATGGAAATGTGCAATGCGGCGAGCGAGTTCCACTTTGTGGACCAGATCTTCTCGACCATGCGGAGCGCCGCCGCGTACCGGATCTACCCGAC
GTCGCAGAGCTACATTGAAGCGATCTACGCTGCCGAGCAGCGCGAGGCGTGGGTGGTGGCGACCAATTTGTTTCTCGAGATGCAGAAAAAGTGTGCAAAA
GATGAAATTTCAGCCACACAACTACAGAAAATCGCACTCGGGCGGTACAGCGAAGGCCGCCACAAGCTGTAG