Transcript Name :
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.56
Orientation:
(-)
Number of Exons:
4
Description :
Ubiquitin carrier protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Cyclic nucleotide-binding domain13.144PS50042
Cyclic nucleotide-binding domain25.948PS50042
Cyclic nucleotide-binding domain8.391PS50042
HmmSmart predictionP-Valprediction_id
Cyclic nucleotide-binding domain6.3SM00100
Cyclic nucleotide-binding domain2.6SM00100
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-961
*** None ***
PositionContextScore
727SSSRKPR|QK0.56
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3125 bases(100 bases per row)
ATGCTGCTCTCATCGCCAGTGGAAATCGTTCGCCATGACGACGCTGCTGCTGAGACAAATCGCTCCGATTCGATTCTACGTCTTGCACTTCTGAAATCAG
GCGACACTTTCGGCGAACGAGCTCTACTTTCCGACGCAGACATGCGAGCAGGTAGGCACACACGCGACTGATCCTCATACTCGTTGTAGAAGTTACTGAT
GGACGATGTATCCCTTTTTCTTCGTGCTAGCATCGGCTATTGTTGCGAGCGATACCGTGGAGCTTGTCTTTATCAGTCGAACCGTTTTCAAAGAGCTGCT
AAAAGAGTCTCAAGAGGCAGAAGCAGGGTCGAATACTCTAGAAATCACCAAGCGATTCCGTTCCAACAAAGATATCATCCGGAACATTTTCGTCCGTCAT
TCAGCTCAGCGGTCCGAAAAGGATCTCAAGTTCGCGGTCGAGTACCTCAAGAGCGTGAAATTCTTTTCGCGATTCTCGTTCGAAGTTCGGAAACAACTGT
GCAAAGCCATGCGTCTGATCAGCGCAGTCACGAACACGGTTTTGTTCGAAGAAGGACAAATCGGAAAGCATTTCTACATCATCTTCTCTGGGAGCGTCGA
AGTCACGGTTCGATCGAAAGACCGTTTTGGAGAAACATCGGAGAACGTCGTCTCTCGGTTGGGTGAAGGCGAGTATTTCGGCGAGCTCGCACTCTCCGAG
GTAGACGGCATCCGGCGAGCGACTGTGAAATGTGCAGATTATTGTGAGCTGCTTGTGCTCAGCCGTGATCAGTATGAGCCGCTAATTAAGAAGTACCAGA
ACGAGTACCATGCCCAATACGCGCATTTACTACGAAAGAATTCGTACTTCATCGGTCCAGAGTGGGACGACAATACGATTGAAGGCATGTGCTCAGTCAT
GACAGAGAAGTATGTTCCGTACCGAGGTGAAGTCTGCAAGCAGGTGAGAGAGAGCACTGGTTTTGAAAAATTGGTTGTCAAGAACTAAAGTATTCGAACA
ACTATTTACTGTCTCACTAGGGCTCGAGAGCATCTGAACTGTTTATTGTCACGAGAGGAGAGTGCCTCATGGTACATGAAGGAAAACATCCGGTCACCAA
CCAGCCGCAGCTGTACGAGCTGGGTCGATTCGGGCCAAATTCCATCATTGGCTGCGCCGAGTAAGTCTCCATCTGAAATCAAGTGTTGGTATATCTCGAG
TTTTCTAACCTTCTTGTTTTGTGCTGTTTATTTACTTGCTCAGAGCTTCTGCAGGAAAATTCAACGACATTTTTGTTCGTGACTACTCGGTGTTTGCGGA
ATCGCCAGTGAAGATACTCGTGCTGTCTCGATTTGACATATTTCACCTCATGTCACCCGAAGCGCGGGAAAGTCTCCAGCACTCAGCAGCTGGGTTCATT
CGAGAAAGCATCGAAAGTCGCGCACTGAAAACTGTTGCCTGGGAACGGTATCGAAAGAAATTCCTCGAGGACTTTATCGCGTCAAAACGAAAAACCGGAA
TCGGATCAGATCGAGGTCCGTCAGGGTTGACGAAATCTACATCGATGCCAGTTCTACAGACTGAAAGTCTAGTCAAAAAGTTGGTCGAGCCAGGATGTTT
GTTGATAGAAGACCACCGAGCGAAGATTGGCTTCAGCAACCGACTAGGCGCCAGATTTAACCCTTCGTTCCAGAATAACATCGACCTGAAACCAGCTCGA
AAACTATCTAGATCCGACGTCAACAAGAGCAATGCTGGCCCCGAATCGGTCGACGATGAGCTCCAGCGTCGGCATTCGGACTCGCTACTACCTTCATCCA
TTGACGAAGACGATCCAAGTCCGTTACCAGACTGCTCGCCCAGCGATGGGAAAGCAAACATGTCACGAAGACACTCTACCAGTGCGACCGAGCTTGCAAA
TCCAGATGGGCTGTCTGCAATGGAAGAAATGAAGAAGATCCTTCTCAGCATCGCTGATGAGGACGTACAACCAAGCGAGCCACCGAGTGGTATAACTCCT
GACAGCCAAAACCAGCGCTTGCCCTCAACTGAAGCGGTACACGTGAGAGACGGCTTGGAGCCAATTCCAGCAACACGGAGAAAGTCGATTGTTTCAGCGC
AAATGCACTCAACTTTGGCGAGAAGCCAAACACTTGCGATGCTAACCCCTTCAGAAGGATCCTTGCCCCCGCTACAGTATGACAAGCCTCTCCATAACCC
GTCAATTACGTCTGGACACAATGGTCACCGCAAAAGCACAAGGTCTATGAAGTCTGACAAACTGTCCGACATCTCAAGTCCGGTATTAAAAGTGCCTACT
GTTACAAGTGTGACCGCGATATGGAATCCTGTCCACGGCGTGTGCCAGCCCTTCTGTTTGCTTGGATATATGAAGGAGAAAGCCACCCCGAAAGCAAGCA
GTTCGTCAAGGAAACCGCGACAGAAGCACTCAGCTGACTTGAGAAAAACAGCAACCAGCAACCACGCCAGCGATGCTGACACTCCCAACACACATCCCTC
CAAAACTGAAGAGTTTGTCATTGCGTTCCGAGTCTTTGGGAAATTTCGAGATCTGAACGAGACTCTGCACGTTTTTCGCCTTGTTTGTGGGCTGGAAAGA
ACGCCGCCGCCAGACAAAGACACTGGGCGATTCGCAGTTTACAAGGAAGACGAAATCACCATGGTTCTCGAAAACTTCTTTTCCACGGAGCCTACAACCG
AGGCACCTCAAGCGGAGCCGCTACCCACTTCTAGCCCATATCAGTTCCGAGCAGGTGATCTGCTCCACGGTAACGGTCAGCGGTTTGCGTGCGTGAGCAT
CATTCACGATCTCCCAGCAACCGCGATCGAAAACGTGACGGTGCATGTGTACCAGTGCTTCCCAACGCTGCAGAGTGCAGTTCGATTCGCGAAGCAGATG
ATGGCGTCGACGTTGACCGCGTCGCTGTACATTGTGCCATTGTTCGACTGGATCCCAGTCGCAGAAATTGATCGGTTCGATGCAAAGAGCTCGGACCTGG
AGCAAGCTCTTGAGACTGTGATGGATCATGGATCCAGCAGCTATCGTAGCACGTGGAAGGCGCGTAAAGACGCCGTCAAGAAAGCGCGAGTGCTCCAGCC
GAGAAGCAAGCCCAAAATCTACTGA