Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-1.24
Orientation:
(+)
Number of Exons:
2
Description :
Serine protease family S01A
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase S1A, chymotrypsin-type3.9PR00722
Peptidase S1A, chymotrypsin-type3.9PR00722
Peptidase S1A, chymotrypsin-type3.9PR00722
Profile scan predictionP-Valprediction_id
Peptidase S126.844PS50240
HmmSmart predictionP-Valprediction_id
Peptidase S19.7SM00020
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6330.76522
InsideOutsideTMhelix
1-503
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
serine-type endopeptidase activityGO:0004252IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        1685 bases(100 bases per row)
ATGAAGGTGAACGCGATCCTCCGTCTCGGCCTCTTGAGCGCCCTCGCGGCCGCCTCCGTGCGCGCCTGGGACTTCACGGACGAACTCGACACGCCGAGCG
CGACCAGCGCGAGCGCCGGCAGCGACGACTCGGCTAACGACGAGCAGCGCATTTACGGCGGCTCGGAGGCCGACGCCTCGCTNNNNNNNNNNNNNNNNNN
NNNNNNCCGTACATCGTGAGTCTGCGTAAGTCGGCGGACGGCACGACGTACTGTGGCGGCTCGCTTATCGCGCCGTCCTACGTGGTCACGGCGGCGCACT
GCGTCAAGGACACGATCACCATGTACGCGTCCATCGGCTCCAAGTACGCCAAGGGCACGCTCGAGGGCGAGCGCATCGCCGTCGCCGAGAGCTTCGTGCA
CCCGCAGTACAACAAGACCGACCACCTGTACGACGTCGCGGTTCTCAAGCTCTCGGCACCGTCGACCATGAAGCCCGTGCCGCTCGCGGCTGCCGACGGC
TCGGACAACAAAGAGAAGACCATGGCGGTCGTGCGCGGCTGGGGCATGACCGAGACCGGCGTCGCCGCCTCGACTATGCAGGAAGTGAACGTGCGCATCA
TCACCAACGCTGAGTGCAACAAGCAGTACAACAACCGCATCACGGAAGGTATGCTCTGTGCCGGTGAAGGCGGCGGCAAGGACTCGTGTCAGGGCGACTC
GGGCGGTCCGCTCGTGTCCAACAACAAGCTCATCGGTCTTGTCAGCTGGGGTGGCGCGTGTGGTGAAGCCGCCGGTGTGTACGTGCGCGTGACGTACGTG
CTGGATTGGATCAATGAGAAGATTGGCGGTGGCGCGGCCACGAACTCAGCCAACTCGGCTGGCAGTGGCTCGACTGGCAGTGGCTCGACTGGCAACGCCA
CCATTGCGACGCCTACTGTGACGACTGCGACACCAACACCAGCTCCAGTCACTGAAGCCCCAACCTCCATTCCTCCAGTGACTGTCGCTCCTGTTACTGA
GGCTCCAGCTACCCCGACTCCAGCTACATCGGCTCCAGCCACTTCGGCCCCAGCCACTACTGAAGCTGCTGTTTCGACGGCTCCGGTCACTTCGGCCCCA
GCCACGACGGCTCCAGCTGCCACCACCGCGGCTCCAACCACGACCGCCCCAGCTACCACTAAAGCGCCAGCTACCACCGACGCTCCAGACAGCGAGTACC
CATCGGAATCTTCGAGTTCGGGTGCCTCCCAAAGCGCTTCTTCTGCGAAGGGATCTTCCAGCGTCTCGTCGGGTGATGTCGTGACGACTGACACGCCAAG
TGCTGCGGCCGGAGCTTCGAGTGCTGCCACTGACACGCCGAGCGCTGCGACCGACAACACTGTGGCCCCTGCTGCTACTACTGCTGTGACCACCTCGGCT
CCTGCCACCTCGGCTCCTGCTGCCACTGAGGCCCCTGTTGTGACTACTCCACCCCCAACGTCGACGCCAGCCAAGAAGGCTGNNNNNNNNNNNNNNNNNN
NNNNGTGCATGATTAACAAGCCCAAGACTGCCGAGAAGAGCGGCGACGTCACGCAGACGTACACCGAGGACAAGGAGCTGGCGGACTCGGAGGACACGGA
AATCCCTGAAGTCGACGAGAACGAAGAGAACAACGAGCACGAGGAGAACGACGAGGAGGAAGAAGAGACCAATGACAGCGAATAA