Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.60
Orientation:
(-)
Number of Exons:
2
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-417
NN-scoreoddsWeighted Score
0.5681.7770.004
PositionContextScore
269SMHRTKR|ND0.587
TypeScore
cytoplasmic739
GO
*** None ***
*** None ***
*** None ***
Sequence
        1360 bases(100 bases per row)
ATGGCGCGCGGCAAGGCGGATCGTGGGCTCACGGTCGGCAAGAAACTCGAGATCATCGACGAAGCTGACCGCACGGGGCTCATCGCCGCGACGGCGCAGA
AGTACGGCGTCAAGACGGGCCAGATCCGCGACTGGAAGAAGAACATCGACCGCCTGCGCGCCACGGACCCAAACCGCCTCGTGTGCGCGAGCACAATCCA
GCGTGGCCACCTGGTCTTCAACGAGACGTACGCGCAGTACTGGGTTGGCTACAACAAGTACTGCTCCAACCACACGAGCTTTGACGAGGTCAAGGACGCA
CTGCGCGTGACCCAGAAGGACGTCGGTCGCGATGGCATCAGTGCGTATTTCTTTGTGCTTTGCTGTTGTTGCTGTGACTTGTGCGCCACTCGCTGAAGAC
TGACTAACTGGCTCACGTGTGTGTGTTCATTCATGTATTGTTGCAGACGTGTTTGCGTTTTCGTCAACCGTGGACCCGACGTCGACGCATGCGCTCGAGT
GCCCGAGCTCCAGTGGCTTCTACACGACACCGGAAGTGAAGGACGTGTACCAGAAGGACATGACGACGCTCCGCGAGCAGCTGCGCGAGTTCTTCGAGCA
CAAGCCGTTCCCGACGAAGTTTATGTACTTTGTCACTAGATTAGATTTTTATAAGCCGGACCCGAGCGCCGACGCGNNNNNNNNNNNNNNNNNNNNNGAA
GCGGACGACGAAGACACGCCGCCTAAGGAGAACGCCGAGTCGGCGAACAAGGAGACGGATTTGGACAACTACATCTCCGTGTACGTCGCGATCTGCGGCA
ACGGCTCGGTGATGGTGCCGATGGCGATTTTCCCACCAACCGAGGAGTGGCACTGGGAGCGCAAGAAGCCAGTCAAGCTGCGCCACGCGTACAGCATGCA
CCGCACCAAGCGCAACGACCCGAACGAGGCGCTGCAGTTCTTCGCTGTGACTTGGAAGAAGTTCTACGACGAAGAAGCCAAATACAGCGACAAGTTCGTG
TTCCTGCTCGACGCGACGCTCGAAGAGTTCCGATCGCCCGAGTTCAACGACGGCCTCAAGCAGCTGGAGGGCCACGGCAAGTACTGGACGACGTTCTTCA
CGGTACGCAACCCGCTTCGTCTCTCGCACTTTGAAGACGTGCTGTCGACTTTCGTGACGGAAGAGTGGCGGAAAATCCTGTCGCTCAAGAAGTCGGCGCA
GCCGAACGATTATCGCAAGTGCGTCGCGTTCTGGTTCTACACGGCGTGGGAGTTCTTCGCGGGCGACTATGCGCGCGCGGCCTTCCGAAGCTGCAACATG
TTCTTGGAAGACAAGTCCGTGTGGTCCACCGAGGAGGGCGAGAGCGGTCGCGTCGTCTAA