Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-1.44
Orientation:
(-)
Number of Exons:
4
Description :
U3 small nucleolar RNA-associated protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2311
*** None ***
PositionContextScore
12RRHRFIR|MD0.57
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        8916 bases(100 bases per row)
ATGACCGAGTCGAAGCGCCGCCACCGCTTCATCCGCATGGACGAGCGGCTGGAGAACCTGCAGACCGAGCTGCAGCTGCATGGCAAGACGAACGCCACGG
AGGTGACGCTTACGTTCCAGGAGGAGCTGGCGCTGCAGGCTGAGCTCACGATGATTGAGAGCTTCCAGATCTTGTACCGCAAGCTGCAGCCGCTCGTGAC
CACGACGCCGCAGCTGCTGCACCACGTCAAGAAGGTCGTCAAGTTGCTGCAGCAGGAGCTCCAGCAGGCGTCGACCACGGAGGTGCAGCGCGAGCGCGTC
AGCCCCGTGCTCAAGCTGCTCACGGCGCTCGCACGCGAGCTGCGCAAGGAATTTTACCCGCACTTTGCCAGCATTTTGCCCGATGTGATCGCCATCATCG
ACACAAAAGACGTACGCATTCATGTATTAGCGGTTGCTATATGCGCTTGTATGAGGAGTTTTTCGTTTTTTCACTGACATTGCGTGCTATGTTTATTGTG
CGTTCAATAGCCTGAGCTGAGTACGCAGGTGTTCAAGACGCTGACGATGCTCTTCAGCTACCTGCGCGTGCAGATCTTGAAGGACATGGAGGCTGTGCAC
AAGTGCTACTTGCCGCTGCTGGGTCACCCGAAGCCGTTCGTGCGCGACTTTGCGGCGCAGACGCTCTCGATCCTGCTGCGCCGCGTCGAGTCGTCCAAGG
ACCTCAAGAAGTACCTGAGCACGTACTTCAAGGCGCTCACGCACGGTTCGGCCAGGGACAACGAAATCCTGCAGGACGGCTCGGCCAAGCTCATGTTCGC
GCTCATGCGCAACGTAAGCCACGGCTTCCATTCGCGCATGGGCGAGATCTTCTTGTTCCTGCTCGGTTCATTCCGCCCCAAGGAGAACGGCGCGCCGGAG
GACCAACTAGCTGTCATCTACGAGATCGTGCGACTCACGTGCGACCTCATGACCAAGCACACGGACGCCGAGAACGCCGGTGGCATGCTCGACTGCTTCG
CGCTCGCACTCAACAAACTGGTGGCGACCACGAATAAGGACAACAACGCCGAGTGCCTGTACCTGAGCCGCATGCTGCACATGTTCGGGTTCTTTGTGCG
CTACCGCGGCGGCCGTCTCGTTGCGCAGGAGAAACAGATCACGACCGTGCAGAGCGTGTGCGCAAAGCTGCTGCCGTCGGATGATCCGACTGAGTCCACC
ATCCTCTCGACGTGCAATGAACCGCTTCGCGACGAGATCGTACCGCTCTTTGAAGGGGTCTGGCGCATCTTCCCAGACAAATCCAACATTGTTGCCGCCC
AGGTGAAGGCGATCTTCTGCGCTGCTGATGACGCGAAGAGCTCCGGCTCGGAAGAGATCAAGACGTACTGGCGAACGCGCCTGATGCAGCTCTCGGAACA
GATCTTCTCACACACAAGCATCGAGGTGGACTTTGTGAAGACGCACGTGTTCCCGAACGCGCTCCACCTGGCGTTTGAGACGTTGCTGCAGGTGGACGTT
GGCGCGTTCTCGGTGCTGATTGCGTCGATGGGCGCGTACGTAGCGAGCCACGAAGACGTCGTGGACGCGAACCCGTACATCGTGTCTGCGAACGACCACC
GCTTTCTGACCTATACGCCAGTGGGGAAGCCAAATTTGACGGACGCGAGCTTGCTCAAGATCGCAAAGCAATTGGTGAGCGAGTGCTTTACACAGGCAAG
CGAGTCGAACACCGAGAAGCAGCGCGCCGCTCTCGCGCTCGCGTGGAAGTTCTGCAAGGCGCTGGCGCTGATCCGCTTGAACGACGACAAGATGCTCGCG
TTCGTGACGCCCGCGATCGCGCAGGTTGAGCAGGCGATGGCGAAGAACCCGCAGGCAGAAACCGTCGCCGAGTTTGGCGCGTTCCGAGCCGAATTGTGGC
GTTTGATGCAGATCGCCGAGCACCAAAAGAAGGCTACAGCCCAGTACTCTACAAAGAAGCAAACCAAGCTCTCGTCGGACTTTGTCGTGAGCGCGCTGAG
CGGCAAGCAGACGTCGTTCGCGACGCTCTCGGCATTCTTTGAGTTCACTCAGATGAAAAGCGAGGCCCAGCAGCACGAACTGCTGAGCAAAGTTGGTTTG
CTCCCAGTCGCGGAGTTGCTGCAGAGCAACCTGCGCTCGCAATCGCACGAGCTGCGCTTGGTGACGCTCGAGCTGCTCGCGCGTCACGACCGCCACGAGT
TCATCGAAGCCGGCGACGTCACGCTGCTGGGCAAGTGCGATCTCCCGGACGTGTGTCTGAGCCTCGAGCGCTTGTGCAGTGGCGTGAGCGTTGATACGGA
ACGCGAGGTCATCCGCTTGATCGGCCGCGTGAAGATCCTGTGCCGTTCGCCGCAGACGCCGCTTGTGTACAAGCTCATCGCCGTGAACCACTTGTTTGGA
CTGTACCACGTCAAGTTTGCGACGATCTGGCCACACATCGCGGACGCTGTGGAGGCCGCGGCGCGCGTGCACTTTGCCGAAGTATGGGCGATCGCCACGC
CCGAGCTCCTCGCCGCCTCGGTGCGCCAGGAAGACAAGAGCTTGACTGCGGGAGCTAATGCTCACGGCGCTCATGACCACAGCAGCAGTGAAGAAGAAGC
CGACAAGGACGCCACTGTGTCTTCCGTGAAGCAGATCCAGAGCGAGTTCGCGAGCGTCTGCGCACTGGAGAAGGGCCAGATCAACCCTTCGAGCGTCACG
GACCTGAGCACGCACCACTCGTTGTTGTGGAAAGGGCTGGAGAAGTTCAGCGACCTGGTCGAGTCCAAGACCAAGTTCATCGTGCCGCTCTTCCTCGTGT
TCTTGCGTGACCAGTACGCTGCGATCTACGCGGACGAGCTGGACCCGAGCATCCTCGAGGGCGTCGACCAGGCGCTCGAGAAACTCGCGACTGCGGGCAC
GCTCGAGGTCACCGAATGGCAGCAGAAGCAGAACTACACGCAGCTTACAACGAAGAACGTGCGCACCAAGTTTCTGGACCAGCTCAAGCTCTTCTCGACG
TTTAAGAACATGAAAGGAGCGTACGCGAACGCGCTGCTGCACGAGTTCTTCTTCGACCTAATCATGAAGTCGGACGAAGTGATTTCCAAGCTCGCGCTCA
AGTGCCTCTTTTGCTTTGGCAAGAAGCACCTGTCGGCCTACAAGGAGCAGCTCAACCGCATCGCGGACTCGACCACGTTCCGCGAAGAGCTCACGAACTT
CAACATCAGCGAGGAGGCCGGCGTCGTGCTCCAAGAGCACCGTCCGCACCTTCTGCCCGTGCTCATGCGCCTCCTGTACTCCAAGTGCGTGAGTAAGAAG
GGCCGCAACACGGGCGACACGGTCGCAGCGCGTCGCTCGGCCATCCTCTCGTACCTCGCCGCGCTGGAAGAAGCCGAGCTCGCGTCCTTCGTGGAGCTCG
TCGTGCGTGCGTTTGACGTAGCGATCGAGCCACCGTCGTCGGCTTCGGGGAAAGCCGGTGCCAAGGTCACGCAGCGTACACACAAGATGGAGATTGCACT
TGATAGCGTGCAACCGTCGCGCATTCTGGGTTTCCTCAACTTGCTGGAGGACCTGGTCGGTCAGCTCGGCACTAAGCTGGCAGCATACGTGCCTGCAATC
GTCGACTTGCTCGTCTCGATCCTCAAGTTCAACGCCGACAGCGCCATCTCTGCTGCTGAGACTGACGATGACGCTGCTGCCGTGGCGATGGACGTTGACG
AGGAGAACACAGAAGAGGACGCCGCCATTGACGAGAAGAAGCCCGAGTACTCGGCGTCCATGCGTAAGCAGATCCGTATGCTCGCGTACCGTCGTTTGGC
TGAAGTGGTCGACACTTTTGACCATGTGGTGACGCTCAAGCCGTGGGTGGAAGCAACTTTTGAGATCTCAAACGACGCGATCCTGCATCTGCCGAACGCG
GTAGTTGGCGCCGCGAAGGCGTCTGCGCTGCTCGACTTCTTGGTCGCGATCTCGCGCGGTGCCACGTCGCGTACCCACCTCACGAAGCCGCTGATCGAGA
GCGTGATCTCGTGTCTGTCTGCAGGTCTCGAGACGGACAAATCGAACAGTAGCGTCGACGCGGCCTCAGCGCGTGGCCTCTCGCCCGAGATCCTCGACTC
GGTGCTGCAGTTCATGGCATCGCTGCTGGACGGCGACGAAGCCAATATGGAGGCGGATGATGACACCACACAAACCACCCAGAAACTGCTGATCCCCGAG
ATCCCGTTCATCTTGGACCAATTCGTCGCGCGTTTCCACTCCAAGACCGCGCGGTACGCTGTCGAACGATACGCGGGTTCGTCCAAGAAGGAGCTGGTGT
TCCTGTGCCGCCTGTCAACCCACATTGGCGCGGCCAAGGCGCTTTCCCCCAAGTCTGCGCACGACCTGTTCCAGCTGCTGCTGCCGTTCTTGCTGCGTAA
CCACCACCCGACGCCCGCGGACAAGGAGAATATCCTGCAGGTGCTCGCGCAGCTGGTGCCGCAGCTCGCAGAGCCGAAGAAGCACGTGTTGTCGCTCTCC
AAGCTGCTCGCACCTGGACCAAACTGTATCATGGAGCGCACGGCGCGTGAGAAGCTCATCGACGTGTTCAAGGCGCTCGGTAGCCACAGCGCGCTGATGC
CGCTGGCCCAGGTCAGCGAGCTCCTCGAAGCGCTGAATGCCTACGACCCCAAGAAGATCGAGGAGATCGACTTTGAGCGCCGCGTAGACGCGCTCAACAC
GGTCAACAACTCGGACTTCGCGGGCTTCCTGGACGACTCACACCTGCTCGCACCACTCGTGAGCCAGTACCTGCACTCGATGCACGACGGCGAGTTCTCG
ATCCGCAGTGGCGCGCTCGCGGGCCTCACGACGTTTGTGCGTCTGGCAGCACAGACCGTGGACGCGAACCCGGTGGAGGTGGTGGACAAGTCGGTGATCA
TGAACGCGCTCGAGTCGCTCGTGATGCCGTGCGTGCGTGTGAGTCTTAAGTCCCCAAGTGAAGATACGCGCCGCGGGTTCGTGATGCTCCTGGGCAACCT
CTCAGACCACAGCGCGTCGCTCAAGCGCTTTGCGTTCGTGCACGCCGACCTGGCACTGCTGCGCAACAAGGACGACCCGGAGGCCGACTTCTTCTACAAC
ATCACGCACATCCAGGCGCACCGCAAGCGCAAGGCGCTGAACCGCGTGGCGTCCATGATGGACCAGATGGCGCTTAAGGTGCGCGCCAAGCAGGATGCTG
ATGATGAGAAGAAGGGCGAGAATGACGATGATGCCATGGAGGTCGATGAGAGCAGCAACGGCAGTTCTGAGATCGAGTGGTTTACGAACTCGACTGTGAA
CAACATCATCCTGCCGCTCGTGCTGCACTTCATATACGAGTCGCAGGCCAAGAGCCAGGAGTCGATCCGTGCCGAGGCCGCGGCGTGTGTCGGTAGCGCG
GCGGGACTGCTCGGCTGGTCGCATTATTTGGCGCTGCTGCGTCGGCTGCTCAAGTCGATCGACGGCCACGAGGAGATGGAGAACACGATCATCCTCGCGA
TCTGCGCGGCGATCGACCACTTCCACTACCCGGCGCCAGGTGCGATCACCGAGTGGGACGGCACGAAGGCCAAGCCCCAACGCGGCGGTCCGCCAGCTGT
TGCACCAGCGGCCAATGGTGACGACGGCTCGTCCAAGATCCAGGACAGCTTGGAGGCCCAGGTGCTGCCGATGCTCAAGAAGTACCTCTTCAAGGGTGTG
ACCAAGAAGGGCAAGGAGAAGGCGTCGACCACCACGTTTGACGACAGCGTTGTGTCCTCACAGCACGTGACAGTACGTGTGCCGCTAGCGCTCGCGATCG
TCAAGGTGCTGCGCCGCCTGCGTGCCGGCGCGTTCTATCTTGAGTTCCCAAAGCTGCTGCTAAGTATCGCCAAGCTGCTCAAGAGCAAGGACGAGGCGAT
CCGATCTTCCTCTCGTACCACGCTCGTGCGCATCACGATGGAGCTCGGCATCACGTACCTGCTGCCGGTGGTCGAGGAGCTTAAGGCCACGCTCCGCGAC
GGGTACATGGTGCACGTGCTCTCGTACACTTTGCACTCGATCCTGGAGAAGGCGACGACGATGATCGAGGCCAAGAAACCGCTCTCACTCGCTGATGCCA
GCGCCCAACAGCAGACTAGTGACAGCAACACTAACGCAGAGCAGGCCTTCGCATCGCCGCTGGATGCGTGCATCCCTAGTATCATGGACATCCTGCTGGA
GGACCTCTTCCGCGGCGTCGTGGAGAACCAGGACGGCTCGGAGCAGAAGAAGTCCAAGATGAAAGAGGCCAAGTCGTCGCGCAGCTACGACGCACTCGAG
CTGCTCGCGCGCAACGTGACGTTCCTGCCGAACCCGAGTATCCACGCGATCGTCGCGGCGCTCGTGCGCAAGTTCCGCGAGAACGAGAACTCCAAGTCGA
CGCTCGTGCTCCACGAGGCGCTCAAGCGCATCGCGCTGGGGCTCGTGAAGAACCCGAGCGTCGAGAAGTCGTACGTGTTCCTCTACGTGTACAACCTGCT
CAACTCGTGTCTCGAGAGCCTGCGTCCGTCGACCGAGCTCGAGAAGGAAAAGTACAAGCAAGTGGCGGCATCCAACTCGCTCGTGAGTTCATGGCTCGTG
AGCGAGAAGAGCAAAAGCGCGACCGCGGAGCTCGCCAAGCGCGTGCACAAGCTCGAGACCGCGAAGGTGGAGCTCCAGGGTCGCATGACGGGCTACAACC
GCCACCAGCTGCAGGACCAGGTGGACTCGATCACGCACCTGGAGGAGCTGCTCAACTTCTCCGTGTTCCTCGTGTTCGCGTTCGTGCGCTCGGGCGAGAT
CTCGCCGTCGCTCGTGGACCCGCTCGTGCCGCACTTGATGCGCTGCGCGTCCGAGGTGAAGAACAACAAGGCCGTGGTGAACGCGCTCAAGTCGCTCAGC
GTGCTTCTCAACCACCACGACATCCCGTCGATGGACGTGGCGCTCGCGCCGCTCGTCGACCGTTTGTTCAAGATCATCCAGAAAGCCGGCGCCGCCACGC
GCAACGAGATGGTGCAGACCTGCTACCGTACCCTCACGGTGATCTTGAAGCATCGCACCGAGTACCGACTCACGGAGCCGCAGCTGCGCGTGCTGCTGAG
CTTTGTGCGCGCCGATCTGGAGGAGAAAGACCACCAGAACGCGACCTACGCGCTGCTCAAGTCGATCATCGCGTCGCGGCTCGTGATTCCCGAGGTGTAC
GACGTGATGCTGCGCGTGGGCGAGCTGCTCGTGCAGGCTGACGCGCAGAGCGCGCGTGCCAACTGCGCGTCGATCTACCTCACGTTCCTGCTCGAGTACC
CTTTGGGTCCGAAGCGCATCACGCACCACCTCACGTTCCTCATGAACAACCTGAGCTACACGTACGAGAGCGGTCGCAAGGCTGTGCTCGAGGCGCTCAG
CGCACTGCTCCGCAAGCTGCCGCTGGACCTGCTGAACGAGCGCGCGCAGTTCTTCATGCTGCCACTCGTGCTGCGTGTGGCGAACGACGAGTCCCCAGCG
TGCCGCGCGCTGGCGTCCGACGTGATCAAGACACTCGTAAAGCGCATCGGCAACCACCAGCTGAACGAGAGTGTGCTGCTCGTGGGCAAGTGGTGGCAGC
AAACCGCGACATCTGGCGACTCGAAATTGCTCTGCACGGCCGCGCAGGTGACGGGCCTCGTACTCGAGTCGCGTCCCGAGTTCTTTGACAAGAGCGCCAT
GGACGTGCTCAAGAACGCCAAGCTGGCGCTTGCCAAGCGCCTCGAGGACATGAACGAGCTCGAGGACAGCGGCGAGCTCGACTGGCAGGTCGCCTACCAC
GTGCTGCTCTGTCTGACCAAGTTCGGCGAGCACCTCGCGGGCAAACTCGAGTCCTGGCTCGCGCTGGAGAACGGCGGGAGCGACTTGATGGACGACATTG
TGCTGCCGCTGCTCGAGTACCCGCACGCGTACGTGCGTCTCGCGGCGCTGCGCTTTGTGACGTCGTACCTGCGTCGCCGTAGCGTCAAGACGCTGGCGTT
CGCGCAGCAGATGAAGCGGCTCAGCGCCAACGTGAGAGGCGACGCGTACCTCAAACAGCCGGGCAAGCTCTTCGCGCTCGCGGCTGGCGTCTCCAAGCTC
TTTGAGCGACCCGAATTCACTGCCGAGGTCGCGGACGAGGCGCTCTATGCGATGCCGTACCTGCTGAGTGCACTCGAAAACTTCTCGTCGATTCCACAGT
ACATGTCGGCGGATCTGCCTGAGGAGGTCGCTGCCAAAGACACGGCTATTGAGGCTGAGGCCACGACCCAGGACGACGATGAAGATGATGAGGACGAGGC
TGGTAAAAGCGGATCTGATAGCGAACAGGACAACGAACCGGAACCTACCAGCATCGCCGAGACCACGATCACGGACGAACAGGAGCAGCAGGACGCGCAG
GCCAAGGCCAAGACCCCCATCGGCTGGATCCTCACGCGCTTCTCGTATCTGTCGCGCGCCGTGAGCGGCGTGGGCATTGTGCGCGTGACGATCTTCAAGC
TCTTTGCCGCGCTGATCAACCAGCACGGCTCTGCTTTCGCTGAACGGTACCTGATGCAGATGCTCAACCCGCTCTTCCGCGCCGCGAGCACGATCAAAGA
ACAGCAGAACCCGTCGGAGAGTGCGCTCCTGGCGCAAGAGGTGCTCGAGCTCCTGGAGGCCAAGATCGGCGCCACGCCGTTCATGGACGCGTACACGTTC
GTGCAGCGCAAGCTCTCGGTGTTCCGCGCCACGCGCAAGGAGAAGCGCAAGCGCGACCTGATCAACGACCCGCAGCTCGCGGCCAAGCGCAAGATCCAAA
AGAACGAGCAGAAGCGCCGCGCCAAGCAGTTTAAGAAGCGCAAGTACACGGTCATGAAGGGCTCGGCCTCGGCGGCCACGCGCCCGCGTAAGGCCATGCG
TCCTGGCGCGCAATAA