Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-0.10
Orientation:
(+)
Number of Exons:
2
Description :
Cullin family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Cullin homology49.379PS50069
HmmSmart predictionP-Valprediction_id
Cullin homology6.3SM00182
Cullin protein, neddylation domain9.5SM00884
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-747
*** None ***
PositionContextScore
243ERSRVAR|YL0.647
*** None ***
GO
Biological ProcessGO IDPrediction Method
ubiquitin-dependent protein catabolic processGO:0006511IEA
KO ID
K03347
K03347
K03347
K03347
K03347
K03347
K03347
K03347
K03347
*** None ***
Sequence
        2315 bases(100 bases per row)
ATGAGCAAAGCGATGATCGGGCTCGAGGACGGCTGGGACCAGGAGATCAAGCCCAAGGCCATCGAGGTGCTGCTCGCGATCTTGGACAAGGGCTTTGACA
AGGTCACGGCGTCGCCCTTCCCGCCCAACACGTTCATGCCGATCTACACCACGTGCTACAACATGTGCACGCAGCGCTCGCCGTACAACTTCTCGGAGCA
GCTCTACGAGCGCCACGGCAGCACCTTCGACACGTACCTGGAGAATAACGTGCTGCCGAGCCTCGAGCGCGCGCACGACGAGTTCTTCCTGCAGGAGCTC
GTCAAGCGCTGGCAGAACCACAAGCTCATGAACAAGTGGATGTCGCGCTTCTTCATGTACCTGGACCGCTACTACGTCAAGCACCATTCGCTGCCGACGC
TCGAGGAAGCCGGCCTGCAGAGCTTTGATCGCGTCGTGTTCCAGAAAGTGAAAGGCCGGGTGAAATGGGCGATGATCGAACTCATCGAGAAAGAGCGCAA
CGGCGAGATCATCGACACGACGCTCATGCGCAACTGCGTCGAGATCTTCGAGGTCATGGGCATGAAGTCGCTCGACGTGTATCAGACTCACTTTGAGGCC
GAGCTCGTGCAGGTGAGCGCGACGTACTATGAGCGCAAGTCAAAGGCTTGGCTCAGCGAAGACTCGACGCCCGTGTACTTGCAGAAGGTGGACGACGCGC
TGCAGGGCGAGCGCAGTCGTGTCGCGCGCTACTTGCACAAGACTACGGAGCCAAAGCTGATCAACCGCCTCGAAGCGGTGCTGTTGGCAGCCGCGCAGAA
GGAGCTCATCGAGCGCGAGAATTCGGGCGTGATTGCACTGCTCAAGTACGACAAACTGGACGACCTCGCGCGGATGTACCGCCTCTTCTCGCGCATCAGG
AACGGTCTTGAGCCGATCGCGGACCTGGTGCAGAAGCACATCACAGCCGTCGGCAACGACATTGTTGAGAAGCGCGCGAATGCTGTCACGAGTGGCAACA
TCAAGGACGCGAGCTCGGACCCGGCGTTCATCAAGGACATTCTCACGATCCACGACAAGTTCCGCAGCATCGTGAACGACCAGTTTGCCGGCAACTCGCT
CTTCCAAAAGGCGCTGAAGGAGGCGTTTGTCGAATTTGTCAACAAGGACGTGGGTCCAGACAGCTCGGCGAAGCTCATGAGCACGTTCTGCGACCGCATT
CTCAAGACTGGCGGCGAGAAGCTAAGCGACGAGCAGGTGGAAGACTACCTTGAGAAGGTGGTATTTGTGTTCTCCTACTTGACCGACAAGGACCTCTTCG
CCGAGATCTACCGCAACCAGTTGGCGAAGCGTCTGTTGAACCAGCGCTCGGCGTCAGCGGATGCTGAAGTGCTGATGATCGGAAAGCTCAAGTTGCGCTG
CGGCGCGCAGTTCACGGGCAAGATGGAAGGCATGATGAACGATCTGGCGATCGGAAGCGACCACCACCAGGAGTTTGAGGGCTTCTTAAAGAACCAGCGC
AGCAACGAGACGGCATCGCCCACGGGCAACATGGAGTTCAGCGTGCAAGTGTTGACAACAGGGTACTGGCCGTCATACAAGGTGCTGGAGATCACGATGC
CTCCCCAGATGGTGCGCTCCATGAACTTGTTCAAGGTGTACTACGACTCGAAGACGAGCCACCGTCGACTGCAGTGGATCCACTCGCTCGGCAATGCCAC
GGTATGAACTACACTTATGTGTACCATAGTAGTGTCGTTGACACCCATGCTGTTGTGCTTTGTGTGTTGTAGATCCGTGCGAACTTCCCAAAGAAGAAAT
GGTACGACTTGCAGGTGACGACACTGCAGGCGGTGGCACTGCTGCTGTTCAACGACGGCGAAGGTGCGCTGTCGTTCGAGACAGTGCGCGAGTCGCTGAA
CCTGTCGGTGGACGTGGTGAAGCGCATTCTGCACTCACTCTCGTGCGGTAAGTACAAGATCCTGGCCAAGCTGCCGGCGGGCAAGACAATCTCGACGAGC
GACAATTTTGAAGTGAACAAGACATTCGCATCGCCCATGCGCAAGATTCGCATCCCGATGGCGTCGCTCGAGGAGAGCCACAGCCAGAAGAACGTGGAGG
AGGACCGAAGTATAGCGATAGAGGCCGCGATCGTGCGCATCATGAAGGCGCGCAAGACGCTGCAGCACCAGCAGCTCATCTCGGAAGTACTCAGCCAGCT
CGCGTTCTTCAAGCCGAACCTCAAGGTGATCAAGCGCCGAATCGAAGCACTCATCGACCGCGAGTACCTGGAGCGCGACCCGGACCAAGCGAACACGTAC
CGCTACCTGGCGTAA