Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-1.2
Orientation:
(+)
Number of Exons:
2
Description :
CG17687 CG17687-PA
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1940
*** None ***
PositionContextScore
919TRNRFDR|LK0.594
1246EEMRRKR|ER0.739
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        6063 bases(100 bases per row)
ATGCCGATTGACGTGACGGCGCGCCACGCGTTCGCGTACAGCGGGCGGCAGCTGCAGCTCGCGGACGAGCACACGATGGTGTACGTGAGCGGCAACACGC
TCGCGTTCACTTCGACGGTGTCCAATTCGCAACACTTCCTGCTGCGCGCCAAGCCGCGGCAGCTGGTCGCGTTCGACTGCAATTGGCGCACGGCCACGGT
CGCGGTCACAGCGCGTGAGCCGAGCCCGGACATCCTGCTCTACTCATATCCGGACAAGAAGCTGCGCGGCAAGCTGCAGCATGGCGCGCGCTTCGAGTAT
TCCAAGATCGTGTTCTCGCGCTGCGGCCGCCGATTGGTGAGTCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACGAGAGCGATGAGAGCGTTA
ATGCAACAGCTACAAGCAGCAGTAGAGATGTCAACCAGAAGCCACGACTGATGGCTGACATCAGCAGTAGCAACAGCAGCAACAACAGCGACACAGACGC
ATCTACTACTACCGCTACCGCCGCCTCAAAGCACCCTGCCAAGCGACAGCGACTGTGTGTGTGGGACGTCGAGCAGCTCGAGCCCGTGAAGGGTTGCGCA
AGTGGCGTCCTCACGATCGACGCCGCGTTCGTGTCGTTCGACCCCGCGAACGCCGATCAGTTCGTCGTTGGAGGTGACGGTGGCATGCAGATCTGGAAGA
TTTACCGCGGCAAAGGTTCGAGTTTGCTCCGCCAGGTGACCGTGCACCTTGGAAGCACCGCTGCTGCGACATCATCATACGGTCGTGTCGGCGCGGTACC
AGTCGGTGGCAGTGGGGACATGGACCCCAGCGACGAGGAGCTCTTTGATCTCGAGGAGAAGCGCAGTCAGTGGATCTGCCACGCATGGGTGAAGAATGAG
CGGCTCTTGGCCGCGAACCGAGCGGGCGAGATGGTTCTCGTGGACGCCGCATCCGCGAACATCGTGCAGATCATCGAGGCGGCGGTCCAGCCGACTCGCT
GCTGCATCGCCGGGATCGTGTACACTGCCGAGGCGGTCGTCGTGTCCTACATCGATGGTCGCGTGCTCTGGTTCAACGAGAAGAACTGGGAGGTCATACA
GTCGGTGTCGTTGCCTGCTAGTGCTACTGCTGGCTCGTCCGCCAATGGGTCAGCAAGCAGTGCAAACAACAACAGCAATGGTGGTGAAGCGAACCTGATC
GCATGCATGGCACCGTCGCCCAACCACTCCAAGATCTACATCGGCACGCGCGACTGCAGCATCTACGAGCTCAAGAGTAGCGTACTCGTAGATGAAGAAG
AGGATGATGACGGCATGGCGGGCATGGTCACGGGTCCGAACAACGACCCGAATGGCAACAACAACAGTGACTCTCATCTTGTCGTCTCGTGTGGGAGTTT
CCCCGTCGGTGCAGTGCTCGCGAGCTCTGCACTGACACCCTCAGGTGGCACGTACCTCAACGACGCTGTGATCGCGAGCGGCGGTGTCAGTGGACGTTTG
TATCTGTGGAGTATTAGCAAGTGCCGTCTCGTGGCGGAAATGAGCCTACCGCTGCTGTTCGCGCACTCACCAGTCTCGCACCCTGCACTTATCGCATCCT
CTGACGGCAGCTTCATGGGCATGGGAGCAGCGACAACGTCAACAACAGGGGGTGTAGGGGCCCAGTCAGCGACTTCAATGAGCCAGATGTCGACCTCTCA
GTCTGGAGAGAGCCTCCCGCCGCCTGGAGGTATGAATGGAGTCGAGTCGGCACCAAACGTCATCATCACCGCATTGGCGTCGAGTCCCGCGGACCCAGTT
CTCATGGTGGGCGACCAGACGGGACGCCTCCGAGCGCTCTGCGTGTCCAAGGTCGTCGGTGGCAACGGCGCCGTGGAGCTCATCCCGCTGCATTCGCTGC
AGCTGGTCGGAGGCGGCGCACCGCTCGACATCCTCGAGATGCATTCGACCCAGGCGGTGCTGCTCGCTGCATCGACAAGAGACAACGTCGTGTTCCTAGT
CTCCATGGACCATGAGAAGCACTTCCAGATAGTCGCGTTCTTCACGCTACTCGAACCAAAAGAGCGCGTCGTGGACGTCAAGTGGAGCGTTCCGGCGCAC
AACACCAGCGCGCTGGTCATCACGTGCTTCTCGTCGCGAGGGCTCTTCTACGTCGCGAGGTACCAGCAGACTGACAGTACTTTAGGAAATAGCGGAGGTG
GTACTGACGATCCCTTTGGGTCCTCGTCCTCCTCGCCGCTGCAACTCAAGACCAAGGTGGTCGCGTTCGGCGAAGACATGCTTCCCAAGTGCACGGCGCT
CAAGTTTCTGATCAACGCGCCGACGAGCATGATGCTCGCGGTCGCCCCCGGAGTCAACAGCCTCCACGTAATGAAGTACATGGAGATGGTGTTCGACCCG
ACCAAGAAGATCAACATTTTGTCCAAGGTGCTGGCGCAGGACGCGCACGAGAACGGTATCTCGACCATGGCGCTGTACTCACGGGCGCTGGTGGACGGCA
GCGAGTTGGTGGCCACCGCAGGTATGAATGGCTCGATCACGGTCTGGCTCGTCTCGTTCGGTGCTGCCAGTTCAAGCGGTGGTGATAGTAGCGCTAGCAC
CTCAGGTATTGCTTCGTCAGGGTCATCGAGAGCGACGGGCAAAGAGTGGCAGCTCGAGGACGTCCAGGCGGCCAAGAAGAAGACCATCGTTGTGCATTCC
GGGCCAGTGACGTCGCTGCTGTTCCTCGACGTCGTGGACGACGTGTACCTGGTGTCCACGGGCTGCGACGGTTGCGTGTTCCTCCTAGACGTACGTATTC
CAACCGACGTGAAAGAGCTCTCATCGTCGTCTACTACTGCTACTGTGGAGCTCAATATGAACCCTTTGTACATCAACATCACAACGTTCGCCAAGTACGA
CGACACGTTCAAGCCCGCGCAAGAGCAGGAGCTCAAGCCGTTCCTCCAGGTGCTTCGCGAGAACGAGGAGTTCAACACGCGCAACCGCTTCGACCGCCTC
AAGGACCAGACACGCGCGCAGCTAAACGACCTGGAGATGAAGCTCAAGATGCTGCTTGCGGAGAACGACAAGCTCCTGGAGACTGAACGCCTGTCACGCG
ACGAGTTTGTGATCAACATCGATTGGCGCGACCGGCTGCTCAAGAAGAACAAGGAGCGCGCCGAGCGCGTGCGTGAGGGGATCCTCAAGGACCTGGCGAA
GATGAACATCGTGCGTGAGCGCATGAAACAGGAGTTCTGGGACTCGGCGACTGTGCAGGGTGTGCGCTTGCGAGGACTCTCGCCTCTGCCTCCCAGTAGC
GGTTCTCAGCAACAGCAACAGCAGCAGAACGGGCTCTTTGTGTACAATTTCCCCATGCGCAGACAGAACAAGCAGGAGCTGCTCATGGCGAAGAAGATCG
AGCTCATGCGCACGATCGAGTTCGCGCACCAGCAGCAGGAGGCCACTGCGTCAGGATCAGCACCAACAACGACAACGGAGACCGCACTCTCACGCTTCAA
CCAGGTGCTCGCGCCGAGCAACAACCTGCAGTGGCTCATCGACGCCGGGATCCACCATCCGTCGCTCAATAAGTTGCTCGCTGAGAAAGCCAAGAGCTTC
AGTGACACCACCGGAGGCGCCCAGAGCTACAGTGAGCTGCAGACGTACCACCTCGTGTACCACCCGGCAGCGATTCGCACGCGCAAGCAGCAGCGCATCC
AGATCCACTTGATCAAGTCCTTTGTGCGCTTCCTCGTGGTCGAGTTCAACGACGAGTTCAACGCACTCGTGCGCCTGAAGGAGACCAAGATCGAGGAGGT
GGAGGCGAAGAACGCGCGCATCCTAGAAATCTGCGCGGAGCTCGGTACCAAGGCCGCGGCGCAAGAGCTCTACCGCCCGCAGCTGACGGCCGATGAGATC
GCGGCGTCCATCCTCGAGGTCAATCCTGAGGAGATGACGCAGAAGATGTACGAGACTGAGGAGATGCGTCGCAAGCGTGAGCGAGAGACACAGGAAAAGC
TCGAGCTCGAGCGCCAGCGTCAGAAGGACGACGTCGCCGGCCGCGCGCTCACCGACATGATGGACGGTACTCTGGAGGTGAAGAAAGAGAACCTGGCAAC
CCAGTCGTTTGTGAAGGAGCAGTGGATGATCGACACGCCCGCGGACGAGATGACTGCCGAGCAGAAGAAGCTTGTCGCGCAGTTCGAGGCCGCGCAGCAG
AAGTTCCTCGAAGAGAAGGAGAAGTACAAGAAGAGTCTTGACCTGGAACTCAAGAAGATCAGGGGCGAGATCAGTGACATCTGCAAGGCCTTTGACGATA
AGCTGCGCGCTTTACAGGAGACGTATTTACATATGCGACGTAGTGTGCTCGTGCAGCATCTGTACGAGCTGCGGCTCGCAGAGGACCTCATGGATCACGA
GCAGCTGTTGCTGGGACGACAGCACATCGAAGAGATGATGCAGGAGCTCCAAAGCGAGATCAAGAAGAGCGAGAAGGAGAACGAGCTCTTTGCAATCCAG
CTCGAAGGATCGAAGGACGAGTGGCACCGCGCGGTGGACGAAGACAAGAGCTGTGAGAAGAACTTTCTCAGGGAACTGGAGGAGCTCACAGTAGGCGCCA
ATGGTACTGGTGCTGGAGCTGCAGCAGCAGCGCCATTGGAGCACGACCTCGTCAAACACCTTGTGGAGCTCTACAAGAAGCGGAAGGGTGACGACTTGCT
GCGTGATGGAGGAGACAGCATGGTGAGGAAAGGAGGCGCGGCGAAGCGCGGGAAGAGCTCTCAGCATCTTGGGATGGGTGCGAGCAGCTCCTTGCTCAAC
ACCAATGGTTCCGGTGCCAATGGCAAACAGCGCCTTCTCGTCGAGGGTTTGGCTGGCGATCCGTCGTCTCGAAACCTCTCGGCAGCAACGCTGCTGCAGA
GTCTGCAGCACTCGAACAGCGACGGCGTGGAGGGCGACTCGAACCTAGACCCTTTCCAGTATCTGGACTACCAGCCGCCGCCACAGCTCAAGCGTCTCGA
CTCTGGTGGCGTGGGTACGAGTCAGCGCCATGTTGCACCGCTGGACTACGATGTCGACCGCCCCGACAGTATCCTCATTGAAGATCGCGTGTGGCGTGTG
CTCAACGCGCTTCGAACCAAGAAGATCCTTGCTGAGCACACATCAAAGGAGAAAGCTGATCAGTACGCGCTCGCAAAGAGCGTCGCCGAGGAGCTTCGCG
CAAAGCTGACCGAGCTCCAGTATACCTTGCAGGAGCAGGCTTCTGCTTATGAAGCCATGACGAGGCAGCTTGAAGCGCTGGCTGAGAACTCACCGCTGCT
GGTGCGCATCAAGCAGGGCCAGGACGAGTCGAGCAGCTGCGGCATGGACTCGGACAACCTGCTCCGATACGCGGCGCCAGCAGACGCTTTGCTCGTCGCG
AGGGCCAGTGTCGAGTCACTAAATGACGTCATCCAGCTGCACGGCAAGGACCAGGTGGGCATCCTGAGTAAGATCAAGAACTTCCGCAAGAACATCAACG
TGATGGAGTGGGAGCACTCGCTGCTGCAGATGCAGACCAAGGACATGGAGGAGCGGTACACGGACATTCAGCTGCTGCGCGTGACGAAAGACCTGCAGGA
GCTCTTCCACACGGGCAATACCTCGGAGAAGCAGAAGCGCGAGATCGCGCTGCTCGAAGCCAAGATGGTGCACTTGGGCAAGAGCCACCAGACGAACCTC
ATCAAGATGGACCAGGCGATGACCAAGCTGCAAAAGCAGTGGCGCGAGCGCGTGCGTGAAAACCAGGGCTTTGAGCAGCAGGCGCAGCAGCTGCAGATGC
AGGTGCAGATCCGCGAAGACATTCTTTCGAGCCGAAAAAGCGCGGCGCTGCGCAACGCGATGCCGTCGTCCGCCAGCGGCGAGTCGGCCGAGAACCCGCA
GCTCAAGGCGATCATCGTGCGCCGCAAGCTCGTGGACTTGGCGAAATCCCAGACCAAGGAGATCGAGTATCTGCGCATGGAACTGGACAATATGCGGAGA
CGAACGTTCCCGAGCTTCGTGCAGCAGGCAGCGCGCGAGTATCACGCGTCGGACACCAGGTAG