Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-1.26
Orientation:
(+)
Number of Exons:
4
Description :
Stomatin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Stomatin family4PR00721
Stomatin family4PR00721
Stomatin family4PR00721
Stomatin family4PR00721
Stomatin family4PR00721
*** None ***
HmmSmart predictionP-Valprediction_id
Band 7 protein4.7SM00244
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Band 7 proteinIPR001107
*** None ***
InsideOutsideTMhelix
1-339
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
membraneGO:0016020IEA
*** None ***
*** None ***
Sequence
        1325 bases(100 bases per row)
ATGCTGCAGCGCTCCGTGCCTCTGTTGCGTACCGTTGCGCCGCGCCGCCTGGCGGTCGAGCAGGCCACCACGACTCGCGGCATCAGTGCCTCACGCGCGC
TACTCTTTGCGTCGCCCTTCGACGACGGCAGCTCGCGGCTGCAGGAGACCCCCGTCAACATCGTGCGTCACGCCCTGTGGAGAACGCCATTCAGCTTTTT
TTTGCGGTAGTCAAAGGAGTATCTAACGCAATGGGTTATGTGTGTGTGGCTGTTTGTATGTGATTGCAGGGCGTGCTGATCGTGCCGCAGCAAAAGGCGT
GGGTGGTCGAGCGCTTCGGCAAGTACCACGATGTGCTCACACCCGGCCTGCACTTCCTCATCCCGCTCGTGGATCGCATCGCGTACGTACACTCGCTCAA
GGAAGAGGCAATCAAAATCCCGGGTCAGTCGGCGATCACGAAGGACAACGTCACGATCAACATCGACGGCGTGCTCTACGTCAAGATCATCGACCCGTAC
AACGCCAGCTACGGGGTGCGTGGCGTATCGCAATCATGGCTGGGATACTGTGGTGCTAGTTTGTGTGTGCTGATTGCATGTGTACCGCTCGTGTGTACTG
CTCGTGCATAATTAGGTGGAAGACCCGATTTACGCGGTGACGCAGCTCGCGCAGACGACGATGCGCTCAGAGCTGGGCAAGATCACGCTCGACAAGACGT
TCGAGGAGCGCGAGTCACTCAACAAGAACATCGTCGAGTCGATCAACCAGGCGTCGGAGGCCTGGGGCATCAAATGCCTCCGTTACGAGATCCGTGACAT
CGCGCCACCAAAGAGCGTGAAGGCCGCAATGGACATGCAGGCCGAGGCCGAGCGCAAGAAGCGCGCCGAGATCCTCGACTCGGAAGGTGAGCGTCAGGCG
TATATCAACGTTGCCGAAGGTAAGAAGCGTGCGGCCGTGCTGGAAGCCGAGGGTGACGCTGCGGCGATCCTCGCGCGCGCGAACNNNNNNNNNNNNNNNN
NNNNNCGGCCGACGCGATTCAGCGACTGTCGGAGGCGATTGTGCGCAAGGGCGGACAGGACGCGGTGGCGCTGCAGGTCGCCGAGAAGTACGTGGAGGCG
TTCGGCAACATCGCGAAGGAGTCGACAACCGTGCTGCTGCCGTCGAACACAAACGACCCGTCGAGCATGGTTGCGTCCGCGCTCTCGATCTTTGCCAACA
TCCAGAAAAAGAACGCGCGCGTCGCGGCGACGCAGAGCGAGAAGGAGGCGAACGAAGAGGCAGAAGGCGTGTACACGCTCGACACCCTGGACGACGACGA
CAACAGCAGCCACAAGATCCAGTAA