Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-0.23
Orientation:
(-)
Number of Exons:
5
Description :
Nuclear movement protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Forkhead-associated (FHA) domain10.048PS50006
Zinc finger, RING-type13.345PS50089
CS domain14.631PS51203
HmmSmart predictionP-Valprediction_id
Zinc finger, RING-type6SM00184
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
CS domainIPR007052
*** None ***
InsideOutsideTMhelix
1-643
*** None ***
PositionContextScore
70TIGRSRR|SD0.727
238KRERHHR|DS0.588
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        2572 bases(100 bases per row)
ATGGTGCAGCGAGTTCGCGCGGGAAGCGCTATGACCTCTGTGGCGACGGCCAGCGAGACGACCAGGAGGACCGCGACGCCGCCTTCGCGACGCAGCTCTC
CTGCGCACATGACACCAGGCAGTAGCAACAGCGCGACACCCACCACGAGTGACGCCTGCAGGTCTCTCTGGCGGTTCTCGCGTGCGTTCACGATCGGCAG
AAGCCGCCGCAGCGACGCGGTCATCCCCACGACCGCCAAGACGCGTACGGTCAGCAAGCTGCATGTGCGCGTGTTCCCCGTGCACGACAGCCAAGCGCTG
AGCTCGCCGACGCCGACGGACCCACATGCGACGATGGTATACGTGAAGCCCACACGATGGATATTGCAGGACCTTGAGGCGATGAACGGGACGTCTCTCA
ACGGGGTCGATGTGCCCCCTGGCGGGTCCGTGGAGCTACATGATGGCGACGAGCTCGTGCTGGCGTCGACGATGCGCCACGGAGCACGAGTGATGATCCA
GATCCTGTATGACGACTACTCGACTATCTCTGTGAAGCTGGAGGATTCAGACACGGTGGCATCACCAACAGAACCGATGACTGCTGAGAGAATCAGCGCA
TCACCAGTGGCGGCGAGATTGGAGAGCCCAGGGTTTCGAACGCCGCCCCCGACTAGAACATCAACGCATTATACTAGCAGCACAGTCGCTACGAAGCGTG
AACGACATCATAGAGATAGCTCGGAAAGAAGACACGAGCATGCAGACGGCAACGAGCCCATGGAAGATGTGGGCGAAGTGGTTCAGCAGCGCAAGCGCAG
TCGTCGTCTCGAGGAGCTAGACGACCAAGACCGATGCATGATGTGTCCGATCTGCTTCGAGTACTTCCACTCGAGCGTCACGCTGCCGTGCTCACACACT
TTCTGCGGTCTGTGCGTGAGCAGTTGGTTCCGATCGTCGCTGTCGTGCCCTCAGTGCCGAACGGATGTGACGAGCCTGCCAGTTCACAATCGCGCATTGG
ACGACCTCGTGCATCGAATCGCAGGCGAGACAGAAGGGTACAAGTCCCTTATTGCGAAGCGAATGAAAGTCCAAGTGGAATACCAACGTCAGCCGCAGAG
AGAGCCCCAGTCCCGCTCGCCTGCGGGGTTCCGCATGCCCACCAACTTCCGGAACCCGTTCCTGAGCGACTCCCCACGCACAAGCAGAGCTGCTTCCACT
ACTACAAGTAGTGCAACTGCTATTAGGACAGTCGTCCCCGTGGACGACAACTCCTCATTGCCGAATGTGTTTACGCGCTGGAAGCAGGAAGAGATCGCGC
GTGTGCGCGCAATTCTCGCCAAGCAGTTCGGCGAGACGCGGCTCCAAACGTGTCGGCGCCTGGGGCTCACCGAGGCGTCGATGAAGCAGGCGTCAACGTC
GCAGACGGCCATCGCGATGCAGAACCTGCTGCTGGACTGGTGGCCGTACGAGCGCGTGCGCGACGAGGGCGACCAGCGGCTCAAGATATTCCTGCATTTT
GGTTGAGCTCCAAGTTGTCGTGTTTGTTTGGTGTCGAAGAGACGCGGAATGTTGCGCGAAAGTGACTCCAAGGCGACCACTTAGATTTGCTTGTTCATTA
GACAATCAGAAGAGAGCCAAAGACGACGACGAAGACGACGAAGAAGACAGATGACGACCGTGGAGCGACGAGTATTTAAGCACAACGGTAGGCGCAGGGG
CTTGTACGAATAAATGAGGGTAGTAACACGAAGGAGGAAGGAAGAGGGTGGTTGTATACATACACACGATACGTTTGCATTCCTAACGAGCACTCGCTTG
CTTTCGGTGTTGGCGCTGCTGTCGTAACGCAAAATGCAAATGCAGACCAAGTGATCTACGAGTGGGAGCAGTCGCTCGAAGAGCTCAATGTGTACATCCG
CCCGCCGCCGGGCATCACCGCCAGCATGATCCTTTGCGAGATCACTGCAAACCACGTGACGCTGGGACTGCGCGGCTCGAACGACAAGTTCCTCAACGTA
CGCACCCTGTGCCAATCATTGCTACTTGCCGCGCGCGTCTTTTGAATAGGTCTGGTGGAATTGATGCTTACACTGTGAGGCGTTTTGTATGAGCAGCATG
ATCTGTCGAGCGCCGTGGTGGTCGCAGAGAGCTACTGGATGCTCGGTGAGTGTTCTATGTGTGTGCGCTGGTATGAGCGTGATGGCGTACTGAACTGACT
GTGCTGCCGTGTGCTATTTGGTAAATGTAAATGGGAGCAGATCAGGGAGAGCTGACGATCAACCTGCAGAAAATGAAAAAAGGACTGATGTGGCCGAGCG
TGTTTGTCGGTCACGGCGAGGTACACTCGTATTCCCAATTGTTGCTGATGATTCTATTGCACACTGTCTGTGCCTCTGCTGACACCAACTACTCTCACTC
TTCCACCTATTTGCTGTTCCAGCTGGACCCGCTGGCGCAGGAAGCAACCAAGCGGCAGATGATGCTCGAGCGCTTCCAGGAGGAGAATCCGGGTTTCGAC
TTCTCCGGCGCAGAGTTCAACGGCTCGGCGCCAGACCCGCGCACGTTCATGGGTGGCGTGAAATACGCCTGA