Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.37
Orientation:
(+)
Number of Exons:
6
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-481
*** None ***
PositionContextScore
145DEQRKAR|EA0.608
212ERIRIKR|QL0.721
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2015 bases(100 bases per row)
ATGGAAAGTGATAGCTACAGCAGCGGCGGTGCCACAGATGACGACTTGCTGGAGCGCGCGCGGCGCTTGTGCCTCGCGGCGCAGTTGATCTCGGACTCGC
TGCCCAAGTTTTCCTTTGGAGCTGCGCGCGGTGGGAACCAAGATGAAGAGACCACCGCTACCACATCGGGCTCCAAGAAAGAACCTCAATGTAGTGCGTC
CAAGAGCAAAGGTTCAGCTGGTGGGTTGCCGCCAGCGAAAGGTAAGAGAAAGACCAAGAGCAATATCAGCAGCAGCAACCAGAGCAGTCTTCCTCCAGCT
GTACTACCCCCCACTCCTCCACCTCAAGTCCCACCACGAACGCGGTCTCTAAAGAAACAGAAGTCGGTGTTGAGCTCCACCAACCAGGAGACTCTTCCAG
AGATCGCCATTTCCGACGAGCAGCGGAAAGCGCGCGAGGCCGAGAAGGTCCGGCAAGCGCAGGAACGAGCGCGCGCTCGCGTGGCCCGCACGAACCAGTC
TGATCAGCTGGAGGCAGAGCGAGAGATTGAAACGCGGAGGCAGCAGTTGCAGCACTTGGAGGATATGAGTGCAGAGAAAGAGAGGCTCGCGGAGCAAAGC
AGGCTGCGTGCAGAGGAGCGTATCCGCATCAAGCGACAGCTTTGTACGCAGCTCAACCCGATCGAGAGACAGCAGTCCCCAGTGTGTCATCCGGAGAAAC
CCCCGGCGGACCCTACCAAGATCGAGCGATTTCGGAGGAAGACGCTCGCGAGATTGCACGCGTACAGCATATTTTTGCTGCAATATTCCGAGTGTGGGCT
TTGGAATTGTGTGTGTTGTGGCTCACCAATGCATTACTCTACTGGTGTTTACTAGGCTACCTCGTAATGCGACACCGAAGACTGTCGACCTCGGACAAGG
TGAACTTGTGGCTGAGATCGACTCGTCACCTGAAAGGGACGAAGATGTTGAAGCTGAAATGAGAAAGCAGAAGGAGAAGAAGCTCCGGCAGGAGACGGCG
GAGCGGATTCGAAGACAGCAGGCGGTCGAGGAAGAGCAGCGGCGGTGAGTTTGCTTTGGTTTCTCCAAATAAATACAACATGCTCATGAAAGCGAGTCGA
GTCTTCATCTCTATGGATCAGCCTCACACCTCTTATTCTCTACCTACAGAAAAGAACAAGAACTCATCCAGCAGGGTTTGCTCCAGTACAAGAACCGACA
GAAGGAGCTCGACCGTGTCGCAAAAGGCTTGGGTCCTCCACGCAAAGTTACCTCTGTCACCAAACAGCCGACCGAGGTACAATCTTGCTGTACTCTTCTT
CATTGGAAGCGTCGCCAGTTGCCTGACTCAACAGTGTCGCTCTTAGGTTCGTCCACATTCAGGAGCTTTACGTGAGGAGACTACTGATCTACCTCTGGAC
CAGAGCCCCAGCAACACCGATGCAGTTCATAGTGATACACAAGGGGTGCCTGGAGATGAGCACCCGCTACACCGCGACAGTGGTTCGTTTGAGCCGAGTG
CAGAGTTTCGACAGCCAGCGCCGCCGAAGTACGACGAAAACGAGNNNNNNNNNNNNNNNAGCCACACGACCATTGGACCAAGGCAGCAACGACGGAAGAA
CCAGAAGAGGACCAGCCATCTAGTCTCGTCATCTCTCTTGATCAGCAAAACGGCGATCCTGGACCACGTGTCTCAAGCGCCACGAGTGGTGGGAAACGAA
AGCTTCCGTCCTGGAAGCGAGCGCCAGTGCCCGTTCTACCAGCCGAGTTCTACTCCAGCAAAGTCGTCATCCCAGTGCGTACACCGACTTGTATAGCTTC
TCCCTGCTGTAGCTGCTAACATACTGGACACTATCATGCATTGATTGATACGTTGGCATCAGGCTTCGCCAGGCACAACTCCGTCCGTATTGGCGACAGC
GTCGAATTCGTACACAGAGAAGTTCAAAGCCCGCACTCCGACTGCCAGCAGTAGCAGCAGTAGCAGCAGCAGTGCTCCAAGTATGCTCAGAGCGACGAAG
CCCAGCAGTCGAGAG