Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.59
Orientation:
(-)
Number of Exons:
4
Description :
Vertebrate c-myc promoter binding protein (MYCPBP)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
MABP domain25.834PS51498
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
MABP domainIPR023341
*** None ***
InsideOutsideTMhelix
1-299
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1132 bases(100 bases per row)
ATGAAGCTCGGCATGGATGAGCTACCAGAAGTGGAACGCAGTGGTTCGCCCCCGGTAGGTGGAACAGCCAACGACAGCGTCAGCGCCAGTAACAACACGG
ACGTAATGCCCGAAATGCCCGGTCCCGAGTGGAAGCATGAGCCTGTGATGCGCAACGCGATCCACACACTGCTGCAAGAGACGAGTCATGATGAAGACGC
ATTTGCGTTTCTGCGCGAGGTCTGTCACGAGACGCTCGCGCGCAAGCAGCGTGCATCGACGAGAGGGTCAGCGGATTTGTTGTGGGGGAGCGGGAGAAGC
AGCATGCGGAATTCCACGCTGGCGTCTAGCGTTGCGTCAGAAGGTGACGAGAGCGTGCTGGCGGGGAAGACGTTGCTCGTCGCACCGAAGAGTCCGCAAG
AGCGACTTTTGGCGCTTGTACCGAACGCGATTGAGAAAGGCAAGCGCAGCTACCAGCGTCGTGCAAGCCCCAAGTACGTCTCACTCCGATGTATAGTGTA
CCTGTTCACAGACGAAAGGTTAGTTGCTCATTCAAACGCTCATTTTCGTTTGCAGTACGAGTGCAGAGGAAGCGCCTCGCTGGAGAAGTGTCGAGAGCGA
TGAGGCTCCGATCACAGATCTGGCTGTCATCTTTACGGGCGACACTGTGCCGGACGGATTCACCAAGGTATGTGCCGACTCCAGCAATTCGATGTGCGCT
TTGTGGTTTACAAGTTTTTTCTTATTTATTCGCGTAGCTTGAGCGATCTCCAAGCGGACTACGAGCAGACTTGAACAAGGGTGGACGAGGCGTATTCGTG
TACCTCTGCTACAGTAGAGACCGGTCAGCCAACAAGCTCCCAATCAGCGAGCTCATCGCCATTTTCCCGGAACGAGGCGAGTTCGTCCCGACAGACTACG
AGATTGCTCAGCGACGAGGAACACCAGCAAACCTCAACACAGTGAGTTTGCAGCACTGCATTTTATCAGCTGGTACTGTAAGCTGCTGATGACTCACTTT
AGTTTGCTGTTTTTCATTTAGGGGACGCAAGGTGAAAAGATCTACTTGTGCTACAAGCGCTCGGTGACGTCTTCAATTGTCGACATGATGGTGCTATTCC
CCAAAAAGGGTGACAAGCTCCCATTCGAGTGA